Labshake search
Citations for LifeSensors :
1 - 29 of 29 citations for PAS Domain Containing Serine threonine Protein Kinase PASK Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... The plasmid containing the gene for human γS WT was engineered into the pE-SUMO (Small Ubiquitin-like Modifier) vector containing a N-terminal 6XHis tagged fusion protein (LifeSensors Inc., Malvern, PA). The γS N14D and γS N76D were generated via site-directed mutagenesis using QuikChangeXL Kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... VU101: Anti-ubiquitin Antibody (VU-0101, 1:1000) was purchased from LifeSensors (PA, USA). Anti-mouse HRP conjugate (W4021 ...
-
bioRxiv - Cell Biology 2020Quote: ... except that human recombinant Usp2Core (LifeSensors Inc., Malvern, PA) was used ...
-
CXCL17 binds efficaciously to glycosaminoglycans with the potential to modulate chemokine signallingbioRxiv - Immunology 2023Quote: The pE-SUMOpro3 AMP vector (Lifesensors Inc, PA, USA) was modified by site-directed mutagenesis to insert a silent AgeI restriction site in the final codon of the SUMO3 open reading frame (ORF) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 5 mM 1,10-phenanthroline (o-PA) (100X, #SI9649, LifeSensors). The total protein content of the lysates was determined by BCA protein assay (#23227 ...
-
bioRxiv - Molecular Biology 2022Quote: ... cell extracts were incubated with Agarose-TUBE2 (LifeSensors, Malvern, PA, USA) at 4°C for 4 h with gentle agitation ...
-
bioRxiv - Biochemistry 2022Quote: ... coli and cloned into a SUMOstar vector (LifeSensors Inc., Malvern, PA, USA) as a C-terminal fusion to an N-terminal small ubiquitin-related modifier (SUMO ...
-
bioRxiv - Genetics 2024Quote: The UbiQuant ELISA kit as directed by the manufacturer (LifeSensors, Malvern, PA) was used to determine the absolute and total amount of ubiquitin and ubiquitylated proteins in the RPE ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 papain-like protease (DB604) was purchased from Lifesensors (Malvern, PA). HCoV-HKU1 coronavirus nucleocapsid protein ...
-
bioRxiv - Cell Biology 2022Quote: ... 2mM NEM (Pierce; Waltham, MA) and 10 μg/ml PR-619 (Lifesensors; Malvern, PA). Protein content determined by BCA assay and samples were diluted in RIPA buffer to 0.4 μg/μL.
-
bioRxiv - Molecular Biology 2020Quote: Agarose-bound TUBE were used as recommended by the manufacturer (LifeSensors, Malvern, PA, USA). mIMCD3 cells were transiently transfected with cmyc-MKS1 and treated with proteasome inhibitor (MG132 at 10μM ...
-
bioRxiv - Neuroscience 2023Quote: Human TDP-43 and TDP-43-GFP were subcloned into pE-SUMO (LifeSensors, Malvern, PA) as described (McGurk et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... FAM20C (amino acids 93-584) was subcloned into a modified pI-secSUMOstar vector (LifeSensors, Malvern, PA) in which the original SUMO tag was replaced by a MBP tag and tobacco etch virus (TEV ...
-
bioRxiv - Biochemistry 2022Quote: ... one with a 50:50 mix of the tanespimycin and mock-treated HT29 lysates (1 mg total protein) in the presence of control magnetic beads without any conjugated antibody (LifeSensors, catalog no. UM400M) (‘–IgG’) ...
-
bioRxiv - Biophysics 2020Quote: ... SARS CoV-2 Mpro gene was subcloned from pET29a(+) to pE-SUMO vector according to manufacturer’s protocol (LifeSensors Inc, Malvern PA). pE-SUMO plasmid with SARS CoV-2 Main protease gene (Mpro ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Then the SARS-CoV PLpro gene (ORF 1ab 1541-1855) was subcloned from the pET28b-(+) to pE-SUMO vector according to the manufacturer’s protocol (LifeSensors Inc., Malvern, PA). The forward primer with the Bsa I site is GCGGTCTCAAGGTGAGGTGAAGACCATCAAAGTGTTCACCACC ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the SARS-CoV-2 PLpro gene (ORF 1ab 1564−1876) was subcloned from pET28b(+) to pE-SUMO vector according to the manufacturer’s protocol (LifeSensors Inc., Malvern, PA). The forward primer with the Bsa I site is GCGGTCTCAAGGTGAAGTTCGCACCATCAAAGTTTTTACC ...
-
bioRxiv - Cell Biology 2020Quote: ... The pull-down of ubiquitinated proteins from protein extracts was performed with TUBE 2 agarose beads (LifeSensors), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis KAI2 protein was expressed as a 6× His-SUMO fusion protein using the expression vector pSUMO (LifeSensors). His-SUMO-KAI2 was isolated from by Ni-NTA resin and the eluted His-SUMO KAI2 was further separated by anion-exchange ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM β-Mercaptoethanol and 5% Glycerol] containing SUMO protease (LifeSensors) in order to cleave the SUMO tag and generate Pol κ in the native form ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were lysed in lysis buffer containing 200 µg/mL TUBE1 (Lifesensors UM101). Lysates were isolated and added 50 µL of glutathione agarose beads (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1mg protein was added to 20μl of TUBE1 agarose (LifeSensors) and incubated for 2 hours at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: Ubiquitinated proteins were analysed using TUBE2 (Agarose, 30 µl per sample, UM402, LifeSensors), TUBE1 (magnetic beads ...
-
bioRxiv - Neuroscience 2022Quote: ... 850 µg protein was incubated with 80 µl equilibrated TUBE1 magnetic beads (LifeSensors) at 4 degrees Celsius for 2 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... Ubiquitinated proteins were pulled down from yeast lysates using Tandem Ubiquitin Binding Entities (TUBEs) (LifeSensors, UM402) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Total Poly-ubiquitinated proteins were isolated using a LifeSensors Tandem Ubiquitin Binding Entities (TUBEs) Kit (LifeSensors, UM411M) and a modified protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 mg of total protein extract was incubated with 100 μL of pre-equilibrated Agarose-TUBEs (LifeSensors), overnight at 4°C on a rocking platform ...
-
bioRxiv - Molecular Biology 2022Quote: ... Immunoblotting was performed using the following primary antibodies: anti-ubiquitin (1:10,000; LifeSensors; MAb; clone VU-1), anti-K48 (1:10,000 ...
-
bioRxiv - Cell Biology 2020Quote: ... and immunoblotting was performed using the following primary antibodies: anti-ubiquitin (1:10,000; LifeSensors; MAb; clone VU-1), anti-K48 (1:10,000 ...