Labshake search
Citations for Tib Molbiol :
1 - 11 of 11 citations for rno mir 542 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Quantitative real-time human-specific primer sets for CyberGreen PCR amplifications were obtained from TIB Molbiol (Berlin, Germany). Primer sequences were:
-
bioRxiv - Neuroscience 2021Quote: ... Main bacterial groups abundant in the murine conventional intestinal microbiota were assessed by quantitative RT-PCR with group-specific 16S rRNA gene primers (Tib MolBiol) (Rausch et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... Copy numbers of the 16S rRNA gene were quantified by quantitative RT-PCR using generic eubacterial primers (Tib MolBiol, Berlin, Germany), and expressed per ng of total DNA.
-
bioRxiv - Microbiology 2022Quote: ... 0.5 mM each primer (TIB Molbiol, Berlin, Germany) and 1.25 U of Optitaq Polymerase (Roboklon) ...
-
bioRxiv - Bioengineering 2020Quote: ... All primers were purchased from TIB Molbiol (Table S10). For the gene expression of the SFBCs ...
-
bioRxiv - Microbiology 2023Quote: ... The probe and primers were designed by TIB MOLBIOL Syntheselabor GmbH ...
-
bioRxiv - Immunology 2021Quote: ... Self-designed primers were synthetized by Tib MolBiol (Berlin, Germany) and used at 100 nM final concentration (listed in Table 2) ...
-
bioRxiv - Molecular Biology 2020Quote: ... using corresponding primers and probe (MS2_F: TGCTCGCGGATACCCG, Ms2_R: AACTTGCGTTCTCGAGCGAT, MS2_P: YAK-ACCTCGGGTTTCCGTCTTGCTCGT — BBQ, TIB MolBiol). The reaction for the internal control was performed using dual detection of FAM and YAK/VIC in a Lightcycler 480 (Roche) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Primers are listed in Supplementary Table 1 (S1) and Actin was chosen as reference gene (TIB Molbiol, Berlin, Germany). Fold change was calculated using the 2-ΔΔCt method ...
-
bioRxiv - Microbiology 2022Quote: ... Viral stock was confirmed by RT-qPCR (LightMix® SARS-CoV-2 RdRp-gene EAV PSR & Ctrl (TIB MOLBIOL). Reactions were run in a LightCycler® 480 real time-PCR system (Roche) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... was combined with 1× Maxima SYBR Green/ROX qPCR Master Mix (Fermentas, Darmstadt, Germany) and forward and reverse primer (0.5 μM; TIB MOLBIOL, Berlin, Germany) in Mx3000P 96-well plates ...