Labshake search
Citations for Tib Molbiol :
1 - 4 of 4 citations for Recombinant Human Chemokine C X C Motif Ligand 10 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and fluorescent probe (5’-6FAM-ACAGACGTTGTATA+C+CAT+G-TMR) (TIB MOLBIOL) RT-qPCR was performed using the following cycle ...
-
bioRxiv - Immunology 2020Quote: ... or CpG (10 μg/ml, TIB Molbiol Berlin). Cell culture imaging experiments with ionomycin stimulation were performed using an open perfusion chamber system ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Quantitative real-time human-specific primer sets for CyberGreen PCR amplifications were obtained from TIB Molbiol (Berlin, Germany). Primer sequences were:
-
bioRxiv - Immunology 2024Quote: ... 10 nM CpG 2216: GGGGGACGATCGTCGGGGGG or CpG 1668: TCCATGACGTTCCTGATGCT (Tib Molbiol) complexed to 30µg dotap (Roche/Merk ...