Labshake search
Citations for Tib Molbiol :
1 - 8 of 8 citations for Mouse Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Primers are listed in Supplementary Table 1 (S1) and Actin was chosen as reference gene (TIB Molbiol, Berlin, Germany). Fold change was calculated using the 2-ΔΔCt method ...
-
bioRxiv - Molecular Biology 2020Quote: ... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... Viral stock was confirmed by RT-qPCR (LightMix® SARS-CoV-2 RdRp-gene EAV PSR & Ctrl (TIB MOLBIOL). Reactions were run in a LightCycler® 480 real time-PCR system (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... Main bacterial groups abundant in the murine conventional intestinal microbiota were assessed by quantitative RT-PCR with group-specific 16S rRNA gene primers (Tib MolBiol) (Rausch et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... Copy numbers of the 16S rRNA gene were quantified by quantitative RT-PCR using generic eubacterial primers (Tib MolBiol, Berlin, Germany), and expressed per ng of total DNA.
-
bioRxiv - Immunology 2023Quote: ... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
bioRxiv - Microbiology 2020Quote: ... and quantified with the LightMix Assay SARS-CoV-2 RdRP RTqPCR assay kit (TIB MOLBIOL, Germany) and the RNA Process Control kit (Roche) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... was combined with 1× Maxima SYBR Green/ROX qPCR Master Mix (Fermentas, Darmstadt, Germany) and forward and reverse primer (0.5 μM; TIB MOLBIOL, Berlin, Germany) in Mx3000P 96-well plates ...