Labshake search
Citations for Tib Molbiol :
1 - 5 of 5 citations for 8 chloro 10 3 dimethylamino propyl phenothiazin 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... or CpG (10 μg/ml, TIB Molbiol Berlin). Cell culture imaging experiments with ionomycin stimulation were performed using an open perfusion chamber system ...
-
bioRxiv - Immunology 2023Quote: ... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
bioRxiv - Immunology 2024Quote: ... 10 nM CpG 2216: GGGGGACGATCGTCGGGGGG or CpG 1668: TCCATGACGTTCCTGATGCT (Tib Molbiol) complexed to 30µg dotap (Roche/Merk ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Primers are listed in Supplementary Table 1 (S1) and Actin was chosen as reference gene (TIB Molbiol, Berlin, Germany). Fold change was calculated using the 2-ΔΔCt method ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... was combined with 1× Maxima SYBR Green/ROX qPCR Master Mix (Fermentas, Darmstadt, Germany) and forward and reverse primer (0.5 μM; TIB MOLBIOL, Berlin, Germany) in Mx3000P 96-well plates ...