Labshake search
Citations for Tib Molbiol :
1 - 9 of 9 citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and fluorescent probe (5’-6FAM-ACAGACGTTGTATA+C+CAT+G-TMR) (TIB MOLBIOL) RT-qPCR was performed using the following cycle ...
-
bioRxiv - Immunology 2023Quote: ... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
bioRxiv - Genomics 2019Quote: For immunisation 8-12-week old ABabDII mice were injected subcutaneously with 100 µg of mutant short peptide (9-10mers, JPT) supplemented with 50 µg CpG 1826 (TIB Molbiol), emulsified in incomplete Freund’s adjuvant (Sigma) ...
-
bioRxiv - Immunology 2023Quote: ... 5 nmol CpG (TIB MOLBIOL, Berlin, Germany), and an equal volume of Incomplete Freund’s adjuvant (IFA ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 nmol CpG (TIB MOLBIOL, Berlin, Germany), and an equal volume of Incomplete Freund’s adjuvant (IFA ...
-
bioRxiv - Immunology 2020Quote: ... or CpG (10 μg/ml, TIB Molbiol Berlin). Cell culture imaging experiments with ionomycin stimulation were performed using an open perfusion chamber system ...
-
bioRxiv - Immunology 2024Quote: ... 10 nM CpG 2216: GGGGGACGATCGTCGGGGGG or CpG 1668: TCCATGACGTTCCTGATGCT (Tib Molbiol) complexed to 30µg dotap (Roche/Merk ...
-
bioRxiv - Microbiology 2020Quote: ... and quantified with the LightMix Assay SARS-CoV-2 RdRP RTqPCR assay kit (TIB MOLBIOL, Germany) and the RNA Process Control kit (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... Viral stock was confirmed by RT-qPCR (LightMix® SARS-CoV-2 RdRp-gene EAV PSR & Ctrl (TIB MOLBIOL). Reactions were run in a LightCycler® 480 real time-PCR system (Roche) ...