Labshake search
Citations for Euromedex :
1 - 26 of 26 citations for ssc mir 376a 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... the slides were immersed in 5X SSC solution overnight (O/N) at RT (Euromedex, EU0300-C). The following day ...
-
bioRxiv - Biochemistry 2020Quote: ... Blots were washed two times at 42°C with 2X SSC buffer (Euromedex, Souffelweyersheim, France) with 0.1% SDS added ...
-
bioRxiv - Molecular Biology 2023Quote: ... The membrane was washed twice with 5X SSC (Saline-Sodium citrate buffer, Euromedex), 0.1% SDS for 15 minutes at 50°C and once with 1X SSC (Euromedex) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.1% SDS for 15 minutes at 50°C and once with 1X SSC (Euromedex), 0.1% SDS for 5 minutes at 50°C ...
-
bioRxiv - Microbiology 2021Quote: ... before being transferred overnight on a nylon Hybond N+ membrane (Cytiva) in a 20X SSC solution (Euromedex). RNAs were UV crosslinked (120 mJoules ...
-
bioRxiv - Neuroscience 2021Quote: ... chemiluminescence was detected using the ECL detection system (Euromedex) and a ChemiDoc MP Imaging System (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... total RNA was isolated from HEK 293T cells using RNAzol®RT (Euromedex). After RNase-free DNase treatment (TURBO DNA-free kit ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... neurons were fixed for 20 min at RT in D-PBS containing 4% (w/v) paraformaldehyde (PFA) (Euromedex #15714-S, Souffelweyersheim, France) and 4% (w/v ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3 times for 5 min in PBS and permeabilized with 0.1% Triton X-100 and 0.02% SDS (Euromedex, EU0660) in PBS for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... the commercially available bacterial two-hybrid kit (BATCH kit, Euromedex) was used [8 ...
-
bioRxiv - Cell Biology 2020Quote: ... Fixed tissues were washed and permeabilized three times 15 min in PBST3 or PBST1 (PBS, 0,3% or 0,1% Triton X-100, Euromedex #2000-C). For antibody staining ...
-
bioRxiv - Developmental Biology 2021Quote: ... Fixed tissues were washed and permeabilized three times 15 min in PBST3 or PBST1 (PBS, 0,3% or 0,1% Triton X-100, Euromedex #2000-C). For antibody staining ...
-
bioRxiv - Immunology 2022Quote: Sorted cells were lysed in 40 μl Viagen Direct PCR Lysis Reagent (cell) (Euromedex) supplemented with 0,5 mg/ml Proteinase K Solution RNA grade (Invitrogen ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... Organoids were then washed with PBS for 3 times for 5 min each and stored in 1:1 ratio PBS and glycerol (Euromedex 15710) before imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
bioRxiv - Microbiology 2019Quote: Bacterial two-hybrid assays were conducted using the BACTH System kit (bacterial adenylate cyclase two-hybrid system kit, Euromedex). The P ...
-
bioRxiv - Microbiology 2021Quote: ... and pKNT25 from the BACTH System Kit (Euromedex) using XbaI and KpnI ...
-
bioRxiv - Microbiology 2023Quote: ... the commercially available BACTH kit was used (Euromedex). In brief ...
-
bioRxiv - Microbiology 2021Quote: The Bacterial Adenylate Cyclase Two-Hybrid System (BACTH System Kit, Euromedex, France) was used to analyze protein–protein interactions ...
-
bioRxiv - Pathology 2021Quote: Total RNA was extracted using the TRI-Reagent kit (Euromedex, Soufflweyersheim, France) and reverse transcription (RT ...
-
bioRxiv - Microbiology 2019Quote: ... BACTH plasmids were made using the Euromedex BACTH System Kit (Euromedex Cat. No. EUK001).
-
bioRxiv - Microbiology 2020Quote: Protein-protein interactions were detected using the bacteria adenylate cyclase two-hybrid system kit (Euromedex) according to product manuals (Karimova et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... The EasyBlocker kit was used to limit unspecific signal according to the manufacturer’s recommendations (GeneTex, Euromedex, Souffelweyersheim, France). In all cases ...
-
bioRxiv - Biophysics 2020Quote: The PscK-PscDC interaction was tested using the bacterial adenylate-cyclase two-hybrid system (BACTH kit, Euromedex, France) [43 ...
-
bioRxiv - Immunology 2023Quote: ... composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics, Euromedex) containing fetal bovine serum ...
-
bioRxiv - Microbiology 2019Quote: The protein–protein interaction of MC58 FHbp and L91543 FHbp with SecA was investigated using the Bacterial Adenylate Cyclase Two-Hybrid System Kit (Euromedex) according to manufacturer’s instructions ...