Labshake search
Citations for Euromedex :
1 - 24 of 24 citations for hsa mir 32 Real Time RT PCR Detection and U6 Calibration Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: A bacterial adenylate cyclase two-hybrid assay was performed as in (32) and following manufacturer’s instructions (Euromedex). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... chemiluminescence was detected using the ECL detection system (Euromedex) and a ChemiDoc MP Imaging System (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... total RNA was isolated from HEK 293T cells using RNAzol®RT (Euromedex). After RNase-free DNase treatment (TURBO DNA-free kit ...
-
bioRxiv - Genomics 2023Quote: ... the slides were immersed in 5X SSC solution overnight (O/N) at RT (Euromedex, EU0300-C). The following day ...
-
bioRxiv - Biochemistry 2020Quote: ... Blots were washed two times at 42°C with 2X SSC buffer (Euromedex, Souffelweyersheim, France) with 0.1% SDS added ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... neurons were fixed for 20 min at RT in D-PBS containing 4% (w/v) paraformaldehyde (PFA) (Euromedex #15714-S, Souffelweyersheim, France) and 4% (w/v ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3 times for 5 min in PBS and permeabilized with 0.1% Triton X-100 and 0.02% SDS (Euromedex, EU0660) in PBS for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... the commercially available bacterial two-hybrid kit (BATCH kit, Euromedex) was used [8 ...
-
bioRxiv - Cell Biology 2020Quote: ... Fixed tissues were washed and permeabilized three times 15 min in PBST3 or PBST1 (PBS, 0,3% or 0,1% Triton X-100, Euromedex #2000-C). For antibody staining ...
-
bioRxiv - Developmental Biology 2021Quote: ... Fixed tissues were washed and permeabilized three times 15 min in PBST3 or PBST1 (PBS, 0,3% or 0,1% Triton X-100, Euromedex #2000-C). For antibody staining ...
-
bioRxiv - Immunology 2022Quote: Sorted cells were lysed in 40 μl Viagen Direct PCR Lysis Reagent (cell) (Euromedex) supplemented with 0,5 mg/ml Proteinase K Solution RNA grade (Invitrogen ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... Organoids were then washed with PBS for 3 times for 5 min each and stored in 1:1 ratio PBS and glycerol (Euromedex 15710) before imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
bioRxiv - Microbiology 2019Quote: Bacterial two-hybrid assays were conducted using the BACTH System kit (bacterial adenylate cyclase two-hybrid system kit, Euromedex). The P ...
-
bioRxiv - Microbiology 2021Quote: ... and pKNT25 from the BACTH System Kit (Euromedex) using XbaI and KpnI ...
-
bioRxiv - Microbiology 2023Quote: ... the commercially available BACTH kit was used (Euromedex). In brief ...
-
bioRxiv - Microbiology 2021Quote: The Bacterial Adenylate Cyclase Two-Hybrid System (BACTH System Kit, Euromedex, France) was used to analyze protein–protein interactions ...
-
bioRxiv - Pathology 2021Quote: Total RNA was extracted using the TRI-Reagent kit (Euromedex, Soufflweyersheim, France) and reverse transcription (RT ...
-
bioRxiv - Microbiology 2019Quote: ... BACTH plasmids were made using the Euromedex BACTH System Kit (Euromedex Cat. No. EUK001).
-
bioRxiv - Microbiology 2020Quote: Protein-protein interactions were detected using the bacteria adenylate cyclase two-hybrid system kit (Euromedex) according to product manuals (Karimova et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... The EasyBlocker kit was used to limit unspecific signal according to the manufacturer’s recommendations (GeneTex, Euromedex, Souffelweyersheim, France). In all cases ...
-
bioRxiv - Biophysics 2020Quote: The PscK-PscDC interaction was tested using the bacterial adenylate-cyclase two-hybrid system (BACTH kit, Euromedex, France) [43 ...
-
bioRxiv - Immunology 2023Quote: ... composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics, Euromedex) containing fetal bovine serum ...
-
bioRxiv - Microbiology 2019Quote: The protein–protein interaction of MC58 FHbp and L91543 FHbp with SecA was investigated using the Bacterial Adenylate Cyclase Two-Hybrid System Kit (Euromedex) according to manufacturer’s instructions ...