Labshake search
Citations for Euromedex :
1 - 9 of 9 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
bioRxiv - Microbiology 2022Quote: ... and plasmids verified by sequencing before BACTH assays (76) were set up according to the manufacturer (Euromedex). Co-transformation of plasmids containing fusion-genes of opposite domains ...
-
bioRxiv - Microbiology 2021Quote: ... total RNA was isolated from HEK 293T cells using RNAzol®RT (Euromedex). After RNase-free DNase treatment (TURBO DNA-free kit ...
-
bioRxiv - Genomics 2023Quote: ... the slides were immersed in 5X SSC solution overnight (O/N) at RT (Euromedex, EU0300-C). The following day ...
-
bioRxiv - Developmental Biology 2020Quote: ... Whole cell extracts were obtained by re-suspending tissues in the following ice-cold lysis buffer (150 mM NaCl (Cat#1112-A, Euromedex), 50 mM Tris-HCl pH 7.4 (Cat#EU0011 ...
-
bioRxiv - Biophysics 2022Quote: ... cells were incubated for 10 minutes in a solution of PBS + 150 mM glycin (26-128-6405-C, by EUROMEDEX) to quench the autofluorescence of the PFA ...
-
bioRxiv - Physiology 2023Quote: ... Cell or mitochondria pellet or tissue powder were resuspended in RIPA buffer (Tris pH 7.4 50mM; NaCl 150 mM; Triton X-100 (EuroMedex, 2000C) 1% ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... neurons were fixed for 20 min at RT in D-PBS containing 4% (w/v) paraformaldehyde (PFA) (Euromedex #15714-S, Souffelweyersheim, France) and 4% (w/v ...
-
bioRxiv - Immunology 2022Quote: Sorted cells were lysed in 40 μl Viagen Direct PCR Lysis Reagent (cell) (Euromedex) supplemented with 0,5 mg/ml Proteinase K Solution RNA grade (Invitrogen ...