Labshake search
Citations for Euromedex :
1 - 31 of 31 citations for Zika Virus Vero Cell Lysate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Cell lysates were incubated for 4 h at 4°C with an anti-Flag antibody coupled to agarose beads (Euromedex). The beads were then washed 3 times with lysis buffer and 1 time with PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
bioRxiv - Immunology 2023Quote: ... composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics, Euromedex) containing fetal bovine serum ...
-
bioRxiv - Immunology 2022Quote: Sorted cells were lysed in 40 μl Viagen Direct PCR Lysis Reagent (cell) (Euromedex) supplemented with 0,5 mg/ml Proteinase K Solution RNA grade (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
bioRxiv - Cell Biology 2021Quote: Cells were fixed in 4% paraformaldehyde (Euromedex), stained using standard immunocytochemical procedures and mounted in ProLong Gold Antifade reagent (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were washed in 5% BSA (Euromedex)-containing PBS ...
-
bioRxiv - Immunology 2022Quote: ... Western blot was realized with following antibodies: Anti-STAT1 (14994, cell signaling), Anti-Phosphorylated STAT1 (9167, cell signaling) Anti-HP1γ (IG-2MOD-1G6-AS, Euromedex), Anti-PD-L1 (4059 ...
-
bioRxiv - Immunology 2021Quote: ... Cells were cross-linked with 1% formaldehyde (Euromedex) for 8 minutes at room temperature and the reaction quenched in 150mM glycine for 10 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were treated with 30 µM Olaparib (Euromedex) for 30 min prior to imaging ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were rinsed twice in ice cold PBS (ET330, Euromedex) and then scraped into 85 μL of RIPA buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cell Biology 2020Quote: Cells plated on coverslips were fixed with Paraformaldehyde (15710, Euromedex), Glutaraldehyde (G5882 ...
-
bioRxiv - Cell Biology 2021Quote: ... mESC cells were crosslinked in 1% formaldehyde (Euromedex, #EM-15686) for 15 min at room temperature and quenched with 0,12 M glycine provided in the kit ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were next cultured with 2.5 µg/ml of puromycin (Euromedex) for the selection of cells transfected with the ORF1-V5-puro replicon.
-
bioRxiv - Cell Biology 2019Quote: ... and cells were transfected using the TransIT-BrCa Transfection Reagent (Euromedex, #MIR5504) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... Cells were treated with 50 mg/mL of zymolyase 20T (EUROMEDEX UZ1000-A) in 200 µL of SB for 30 min at 30 °C ...
-
bioRxiv - Microbiology 2021Quote: ... total RNA was isolated from HEK 293T cells using RNAzol®RT (Euromedex). After RNase-free DNase treatment (TURBO DNA-free kit ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were fixed 15 min at 4°C with PFA 4% (15710, Euromedex) after 7 days of culture ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were rinsed with ice-cold Phosphate Buffer Saline (PBS) (Euromedex, ET330-A) and lysed on ice in a buffer containing 50 mM Tris-HCL (pH 7.4) ...
-
bioRxiv - Genetics 2023Quote: ... cells were treated with 200 µg of RNase A (Euromedex, cat.9707-C) at 37°C overnight ...
-
bioRxiv - Cancer Biology 2019Quote: RNA was extracted from homogenized mouse organs or from cells using TRIzol reagent (Euromedex) following the standard protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... installed in Mini-PROTEAN® tetra vertical electrophoresis cell filled with 1X TG-SDS solution (Euromedex). The gels were run for 1 h at constant 150 volts ...
-
bioRxiv - Microbiology 2022Quote: ... THP-1 cells media was also supplemented with 0.05 mM β-mercaptoethanol (Euromedex, cat. 4227-A) and 10 mM HEPES (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: Cells were permeabilized for 30 min at room temperature with PBS 0.2% Bovine Serum Albumin (BSA, Euromedex, 04-100-812) and 0.05% Saponin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2019Quote: Cells were permeabilized for 30 min at room temperature with PBS + 0.2% Bovine Serum Albumin (BSA, Euromedex, 04-100-812) and 0.05% Saponin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... MAPKi-treated cells were cultured in a medium containing 1 µM vemurafenib/cobimetinib (with 500 nM vemurafenib and 500 nM cobimetinib) (Euromedex) for 24 h ...
-
bioRxiv - Biophysics 2022Quote: ... cells were incubated for 10 minutes in a solution of PBS + 150 mM glycin (26-128-6405-C, by EUROMEDEX) to quench the autofluorescence of the PFA ...
-
bioRxiv - Immunology 2023Quote: ... The muMECs were seeded in T75 tissue culture flasks pre-coated with gelatin-based coating solution for 2 min (from Cell Biologics, Euromedex) and cultures were divided twice a week or as necessary ...
-
bioRxiv - Microbiology 2023Quote: ... was used to transfect plasmids into low passage HeLa cells with selection being performed using G418 at 800ng/mL (Euromedex, #EU0601) for 7 days ...
-
bioRxiv - Immunology 2023Quote: ... and purified Tregs at a ratio 1:1 in 96-well plates pre-coated with gelatin-based coating solution (from Cell Biologics, Euromedex).
-
bioRxiv - Cell Biology 2020Quote: ... cells were incubated in an appropriate buffer solution at pH6 containing bromo-4-chloro-3-indolyl-β-D-galactopyranoside (Euromedex, Souffelweyersheim, France), as described previously (Gorwood ...