Labshake search
Citations for Euromedex :
1 - 5 of 5 citations for Zika Virus Lysate MR766 strain since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... while strain BTH101 (Euromedex) – a non-reverting cya mutant – was used in BACTH assays29 ...
-
bioRxiv - Microbiology 2023Quote: ... coli Δcya mutant strain BTH101 (Euromedex) by calcium chloride transformation ...
-
bioRxiv - Microbiology 2020Quote: Combinations of the above T18 and T25 fusion proteins were transformed into the BACTH compatible strain BTH101 (Euromedex) for analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
bioRxiv - Microbiology 2021Quote: ... Cell lysates were incubated for 4 h at 4°C with an anti-Flag antibody coupled to agarose beads (Euromedex). The beads were then washed 3 times with lysis buffer and 1 time with PBS ...