Labshake search
Citations for Euromedex :
1 - 16 of 16 citations for Recombinant Enhanced Green Fluorescent Protein His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Blue-fluorescent DNA stain 4’,6-diamidino-2-phenylindole (DAPI) was purchased from Euromedex (Souffelweyersheim, France). Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Blue-fluorescent DNA stain 4’,6-diamidino-2-phenylindole (DAPI) was purchased from Euromedex (Souffelweyersheim, France). Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: Protein-protein interactions were evaluated using the Bacterial Two Hybrid System (Euromedex) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2020Quote: Protein-protein interactions were detected using the bacteria adenylate cyclase two-hybrid system kit (Euromedex) according to product manuals (Karimova et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteins were loaded on 10% SDS-PAGE gels in parallel with a protein prestained ladder (Euromedex) and transferred onto PVDF membranes (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
bioRxiv - Microbiology 2020Quote: ... Protein expression was induced using 40 μM IPTG (Euromedex) and carried out overnight at 18°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Molecular weight were checked using a Prestained Protein Ladder (#06P-0111, Euromedex).
-
bioRxiv - Plant Biology 2021Quote: ... Proteins were transferred on nitrocellulose membrane 0.45 μm in 1xTris-Glycine (Euromedex®), 20%EtOH transfer buffer at 100 V for 1h ...
-
bioRxiv - Microbiology 2023Quote: Interactions between proteins of interest were screened using the BACTH bacterial two-hybrid system (Euromedex) as described by Karimova et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were separated by migration at 135 V in 1X Tris-Glycine-SDS buffer (Euromedex). Proteins were electro-transferred on a nitrocellulose membrane in 1X Tris-Glycine buffer supplemented with 20% ethanol ...
-
bioRxiv - Microbiology 2020Quote: Proteins were fractionated by performing SDS-PAGE (12% except where indicated) stained with Coomassie blue (Euromedex, Souffelweyrshim, France). For immunoblot analysis ...
-
bioRxiv - Microbiology 2020Quote: Combinations of the above T18 and T25 fusion proteins were transformed into the BACTH compatible strain BTH101 (Euromedex) for analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 1h in 37°C and proteins were then digested with Proteinase K (Euromedex, final concentration 0.4 mg/ml) for 2h at 37°C and the temperature was then shifted to 65°C overnight to reverse cross-links ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples migrated on 7.5% (for proteins over 200kDa) or 10% SDS-PAGE polyacrylamide gel at 140V with 1xTris-Glycine SDS running buffer (Euromedex®). Proteins were transferred on nitrocellulose membrane 0.45 μm in 1xTris-Glycine (Euromedex®) ...
-
bioRxiv - Microbiology 2022Quote: ... Equal amounts of GST or GST-Trim69 proteins were then bound to 10 μg of pure porcine brain tubulin (purchased from Euromedex, cat. CS-T240-A) in a total volume of 40 μl of PEM buffer supplemented with 40 μM of Taxol and 1mM GTP ...