Labshake search
Citations for Euromedex :
1 - 4 of 4 citations for Rat SEPT12 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Gene encoding TurboFP650 was amplified from the plasmid pTurboFP650-N (Evrogen, Euromedex, France) with primers TurboFP650-XbaI 5’TGCTCTTAGATTTAAGAAGGAGATATAGATATGGGAGAGGATAGCGAGCTG3’ and TurboFP650-SphI 5’CATGCATGCTTAGCTGTGCCCCAGTTTGCTAGG3’ ...
-
bioRxiv - Microbiology 2019Quote: ... BACTH plasmids were made using the Euromedex BACTH System Kit (Euromedex Cat. No. EUK001).
-
bioRxiv - Microbiology 2022Quote: ... and plasmids verified by sequencing before BACTH assays (76) were set up according to the manufacturer (Euromedex). Co-transformation of plasmids containing fusion-genes of opposite domains ...
-
bioRxiv - Microbiology 2023Quote: ... was used to transfect plasmids into low passage HeLa cells with selection being performed using G418 at 800ng/mL (Euromedex, #EU0601) for 7 days ...