Labshake search
Citations for Euromedex :
1 - 49 of 49 citations for P N Nonylphenol Diethoxylate Unlabeled 500 Ug Ml In Acetonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... N-(2-Hydroxyethyl)piperazine-N′-(2-ethanesulfonic acid) (HEPES-KOH pH 7.4 20 mM; EuroMedex, 10-110); Sucrose 110mM ...
-
bioRxiv - Developmental Biology 2020Quote: ... the coverslips were incubated with a secondary antibody (anti-rabbit antibodies conjugated with Alexa fluorophores diluted 1:500) for 45 min in blocking solution supplemented with ribonuclease inhibitor (0.8 μl/ml; Euromedex). Coverslips were then washed three times with PBS for 5 min at RT ...
-
bioRxiv - Zoology 2024Quote: Single adult mosquitoes were homogenized in a 1.5 ml Eppendorf tube with plastic pestle in 500 µl of TRI Reagent (Euromedex, France) before RNA extraction according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... Cells were centrifuged for 1 minute at 16000 xg and resuspended in 500 μL 50 mM Na-Citrate buffer containing 5 μL of RNase A (10 mg/mL, Euromedex, RB0474) and incubated for 2 hours at 50°C ...
-
Negative curvature-promoting lipids instruct nuclear ingression of low autophagic potential vacuolesbioRxiv - Cell Biology 2021Quote: ... Cells were centrifuged for 1 minute at 16000g and resuspended in 500 μL 50 mM Na-Citrate buffer containing 5 μL of RNase A (10 mg/mL, Euromedex, RB0474) for 2 hours at 50°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 250 ng of Pd(N)6 random hexamers (Euromedex PM-301L). Real-time qPCR of reversed transcribed RNAs was run with SYBR® Green Master Mix (Biorad ...
-
bioRxiv - Microbiology 2021Quote: Gene encoding TurboFP650 was amplified from the plasmid pTurboFP650-N (Evrogen, Euromedex, France) with primers TurboFP650-XbaI 5’TGCTCTTAGATTTAAGAAGGAGATATAGATATGGGAGAGGATAGCGAGCTG3’ and TurboFP650-SphI 5’CATGCATGCTTAGCTGTGCCCCAGTTTGCTAGG3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... MAPKi-treated cells were cultured in a medium containing 1 µM vemurafenib/cobimetinib (with 500 nM vemurafenib and 500 nM cobimetinib) (Euromedex) for 24 h ...
-
bioRxiv - Genomics 2023Quote: ... the slides were immersed in 5X SSC solution overnight (O/N) at RT (Euromedex, EU0300-C). The following day ...
-
bioRxiv - Microbiology 2021Quote: ... before being transferred overnight on a nylon Hybond N+ membrane (Cytiva) in a 20X SSC solution (Euromedex). RNAs were UV crosslinked (120 mJoules ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 mM KCl) were incubated on ice with 50 mM DTT (Euromedex, EU0006), final concentration ...
-
bioRxiv - Microbiology 2020Quote: ... and selected using 100 μg/mL ampicillin or 50 μg/mL kanamycin sulphate (Euromedex). Agarose Gel purification and DNA plasmid extraction kits were purchased from Macherey-Nagel.
-
bioRxiv - Microbiology 2022Quote: ... and selected using 100 µg/mL ampicillin or/and 34 µg/mL chloramphenicol (Euromedex). Agarose gel purification and DNA plasmid extractions were performed using a QIAquick Gel extraction kit (QIAGEN) ...
-
bioRxiv - Immunology 2021Quote: Colon biopsies were crushed in 500 µL of Trizol (Molecular Research Center, Euromedex, Souffelweyersheim, France) in Precellys lysing kit tubes (Bertin Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... RNase A (20 μg/ml, Euromedex) and 2 M NaCl for 1.5 h at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... and 10 mg/mL rapamycin (Euromedex) were prepared in dimethylsulfoxide (DMSO ...
-
bioRxiv - Biochemistry 2023Quote: ... and 0.1mg/ml Phenylmethylsulfonyl fluoride (PMSF; Euromedex). Lysed cells were centrifuged for (38,400g ...
-
bioRxiv - Microbiology 2021Quote: ... cultures were ice cooled to 20°C for 10 min then induced with 500 μM of IPTG (Euromedex) for 12h after which cultures were centrifuged and stored as dry pellets at −80°C.
-
bioRxiv - Molecular Biology 2019Quote: ... De-proteinated plugs were washed with 10 ml TE followed by washing with 10 ml TE + 1 mM AEBSF (Euromedex) for 2 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... and DNase I (0.1 mg/mL) (1307, Euromedex) in PBS for 10 min at 37°C under agitation ...
-
bioRxiv - Cancer Biology 2024Quote: ... or 50 µg/mL proteinase K (Euromedex EU0090-A). The reaction was stopped by adding 2 µL phenylmethanesulfonyl fluoride solution at 200 µM for 10 min on ice.
-
bioRxiv - Microbiology 2023Quote: Stock solutions of 10 mg/mL caspofungin (Euromedex, Souffelweyersheim, France) and 10 mg/mL rapamycin (Euromedex ...
-
bioRxiv - Genomics 2023Quote: ... 50 mL of culture was fixed in 1% formaldehyde (Euromedex), quenched with glycine ...
-
bioRxiv - Cell Biology 2020Quote: ... 5% glycerol) supplemented with 0.25 mg/mL lysozyme (5934-D, Euromedex), 1 mM phenylmethylsulfonyl fluoride (Sigma) ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were next cultured with 2.5 µg/ml of puromycin (Euromedex) for the selection of cells transfected with the ORF1-V5-puro replicon.
-
bioRxiv - Biochemistry 2023Quote: ... 1μM ACKR3 agonist VUF11207 and protease inhibitors: 50μg/ml Leupeptin (Euromedex), 0.1mg/ml Bensamidine (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2021Quote: ... 5 mM β-mercaptoethanol and complemented with 0.025 mg/ml RNAse (Euromedex), 0.025 mg/ml DNAse (Sigma Aldrich ...
-
bioRxiv - Physiology 2020Quote: ... Genomic DNA was extracted using Proteinase K (20 mg/mL; Euromedex, France) and 1 mM of Tris-EDTA Buffer (pH = 8) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Genomic DNA was extracted using Proteinase K (20 mg/mL; Euromedex, France) and 1 mM of Tris-EDTA Buffer (pH = 8) ...
-
bioRxiv - Microbiology 2023Quote: ... growth media were supplemented with chloramphenicol (Cm 25 μg/mL; EUROMEDEX, China). The strain Lactococcus lactis ssp ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1 mg/ml X-Gal (ref EU0012-D, Euromedex, Souffelweyersheim, France) previously resuspended in N-N’ dimethylformamide ...
-
bioRxiv - Genomics 2021Quote: ... Cells were treated with 50 mg/mL of zymolyase 20T (EUROMEDEX UZ1000-A) in 200 µL of SB for 30 min at 30 °C ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1 µg/mL of goat anti-bat biotin-labeled IgG (Euromedex, Souffelweyersheim, France) was added to each well and incubated for 30 min at 300 rpm at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... diluted in blocking solution in the presence of a ribonuclease inhibitor (0.8 μl/ml; Euromedex) for 45 min at RT ...
-
A quantitative tri-fluorescent yeast two-hybrid system: from flow cytometry to in-cellula affinitiesbioRxiv - Biochemistry 2019Quote: ... 1/2000 in PBS + tween 0.2% (v/v) + 10 mg/ml BSA (Albumin bovine fraction V, Euromedex). The membrane was then washed four times seven minutes in blocking buffer at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... the animals were intraperitoneally injected with 200 µL of 15 mg/mL D-luciferin (Euromedex, #12507-AATD), anesthetized with isoflurane inhalation ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 1h in 37°C and proteins were then digested with Proteinase K (Euromedex, final concentration 0.4 mg/ml) for 2h at 37°C and the temperature was then shifted to 65°C overnight to reverse cross-links ...
-
bioRxiv - Immunology 2022Quote: ... anti-human IgG or anti-human IgA antibodies (Jackson ImmunoReseach, 0.8 µg/ml final) and by adding 100 µl of HRP chromogenic substrate (ABTS solution, Euromedex) after washing steps ...
-
bioRxiv - Cell Biology 2022Quote: ... cell pellets were incubated with lysis buffer (10 mM Tris pH 8; 1mM EDTA; 0.5% SDS; 60 µg/mL Proteinase K (EU0090-C, Euromedex) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1mM EDTA) and suspended in a mix of 90 µL TE buffer + 10 µL lysostaphin 35520 U/ml (EUROMEDEX) + 2,5 µL RNasin Plus 40 U/µl (Promega) ...
-
bioRxiv - Cell Biology 2019Quote: ... The culture medium was supplemented with 80 mM NaCl for the root-growth experiment and with 100 µg/ml kanamycin sulfate (Euromedex) or 25 µg/ml hygromycin B (Duchefa ...
-
bioRxiv - Microbiology 2021Quote: ... The mixture (2.5 µL) was deposited on the surface of 1 mL of tryptone-NaCl medium solidified with 2% agarose D3 (Euromedex) poured in 2 mL micro tubes and incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... The mixture (2.5 µL) was deposited on the surface of 1 mL of tryptone-NaCl medium solidified with 2% agarose D3 (Euromedex) poured in 2 mL micro tubes or in wells of 24-well plates and incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... The mixture (2.5 µL) was deposited on the surface of 1 mL of tryptone-NaCl medium solidified with 2% agarose D3 (Euromedex) poured in 2 mL microtubes or in wells of 24-well plates and incubated overnight at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... plugs and incubated overnight at 55 °C in a digestion buffer with 1 mg/mL of proteinase K (Euromedex EU0090). Then plugs were washed with TE buffer (50 mM Tris ...
-
bioRxiv - Microbiology 2019Quote: ... Yeasts were washed once in SPM buffer and incubated for 1 h at 30°C in 1 mL of a solution containing 2 mg of Zymolyase 20T (Euromedex®), 100 mg of lysing enzymes from Trichoderma harzianum (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... 1μL was then spotted on LB media supplemented with 40 μg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) (Euromedex), ampicillin (Amp ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were centrifuged for 1 minute at 16000 g and resuspended in 50 mM Na-Citrate buffer containing 5 µL of RNase A (10 mg/mL, Euromedex, RB0474) for 2 hours at 50°C ...
-
bioRxiv - Microbiology 2023Quote: ... was used to transfect plasmids into low passage HeLa cells with selection being performed using G418 at 800ng/mL (Euromedex, #EU0601) for 7 days ...