Labshake search
Citations for Euromedex :
1 - 50 of 50 citations for N Nitrosodiphenylamine 2 2 4 4 6 6 D6 96% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Blue-fluorescent DNA stain 4’,6-diamidino-2-phenylindole (DAPI) was purchased from Euromedex (Souffelweyersheim, France). Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Blue-fluorescent DNA stain 4’,6-diamidino-2-phenylindole (DAPI) was purchased from Euromedex (Souffelweyersheim, France). Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... N-(2-Hydroxyethyl)piperazine-N′-(2-ethanesulfonic acid) (HEPES-KOH pH 7.4 20 mM; EuroMedex, 10-110); Sucrose 110mM ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 250 ng of Pd(N)6 random hexamers (Euromedex PM-301L). Real-time qPCR of reversed transcribed RNAs was run with SYBR® Green Master Mix (Biorad ...
-
Kinetochore individualization in meiosis I is required for centromeric cohesin removal in meiosis IIbioRxiv - Cell Biology 2020Quote: ... For whole-mount staining of stable spindle microtubules oocytes were incubated 2-6 min in a cold treatment solution (80mM PIPES (Euromedex, 1124), 1mM MgCl2 (Euromedex ...
-
bioRxiv - Neuroscience 2020Quote: ... 6 % agarose (LE-8200-B, Euromedex) PBS solution ...
-
bioRxiv - Genetics 2021Quote: ... 6 μL of Proteinase K (Euromedex, EU0090-C) were added and after 1 hour at 50°C ...
-
Negative curvature-promoting lipids instruct nuclear ingression of low autophagic potential vacuolesbioRxiv - Cell Biology 2021Quote: ... 6 μL of Proteinase K (Euromedex, EU0090-C) were added for 1 hour at 50°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 6 µL of Proteinase K (Euromedex, EU0090-C) were added for 1 hour at 50°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were fixed 15 min at 4°C with PFA 4% (15710, Euromedex) after 7 days of culture ...
-
bioRxiv - Cell Biology 2021Quote: Cells were fixed in 4% paraformaldehyde (Euromedex), stained using standard immunocytochemical procedures and mounted in ProLong Gold Antifade reagent (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... fixed with 4% paraformaldehyde (Euromedex, cat. 15713), quenched with 50 mM NH4Cl (Sigma cat ...
-
bioRxiv - Cell Biology 2021Quote: ... fixed with 4% paraformaldehyde (Euromedex, cat. 15713) for 10 min ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... After fixation using 4% Paraformaldehyde (Euromedex 15710) in PBS for 1h at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... Cell lysates were incubated for 4 h at 4°C with an anti-Flag antibody coupled to agarose beads (Euromedex). The beads were then washed 3 times with lysis buffer and 1 time with PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.1% Tween-20) containing 4% dehydrated half-creamed milk, and incubated (overnight, 4°C) rabbit anti-MFGE8 (1/1000, Euromedex), then with anti-mouse horseradish peroxidase-conjugated antibodies (1/3000 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2% agarose D3 (Euromedex, France ...
-
bioRxiv - Physiology 2020Quote: ... Samples were fixed 24 hours in 4% PFA (15714, Euromedex) and decalcified in 19% EDTA (EU00084 ...
-
bioRxiv - Neuroscience 2022Quote: Fixation was performed in 4% paraformaldehyde (PFA, EMS Euromedex, #15710) for 20 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: Vibratome sections were permeabilized and blocked with PBTA2 solution (2% BSA, 2% FBS, 1% Tween20 (Cat#2001-A, Euromedex) for 2h at room temperature ...
-
bioRxiv - Physiology 2022Quote: ... Non-specific binding was blocked with 4% bovine serum albumin (BSA, Euromedex) diluted in 1X PBS supplemented with Tween 0.1% ...
-
bioRxiv - Developmental Biology 2022Quote: Embryos were fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Developmental Biology 2019Quote: Embryos are fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: Embryos are fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were fixed with 2 % paraformaldehyde (PFA, EMS, Euromedex) in phosphate-buffered saline (PBS ...
-
bioRxiv - Developmental Biology 2023Quote: Embryos or doublets are fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and then fixed in a mixture of methanol-free 4% paraformaldehyde (PFA, Euromedex EM-15710) and 0.2% Glutaraldehyde (Euromedex ...
-
A quantitative tri-fluorescent yeast two-hybrid system: from flow cytometry to in-cellula affinitiesbioRxiv - Biochemistry 2019Quote: ... and one incubation of 15min at 4°C in 500µl of PBS 0.1M Glycine (Euromedex). Finally ...
-
bioRxiv - Developmental Biology 2020Quote: E13.5 and E15.5 embryos paws were collected and fixed in 4% PFA-PBS pH7.5 (Euromedex) for 6 hours prior washing them three times in PBT ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were incubated with primary antibodies at 4°C overnight in TBST 0.05% with 5% BSA (Euromedex), washed 3x 10 min with TBST 0.05% ...
-
bioRxiv - Immunology 2021Quote: ... and then rocked overnight at 4°C in TBST 5% BSA (Fraction V, 04-100-812-C, Euromedex) with primary antibodies ...
-
bioRxiv - Developmental Biology 2023Quote: Embryos in the inverse bleb phase were fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were denatured by boiling in loading buffer (4× 100 mM Tris-HCL, pH 6.8, 8% SDS (Cat#EU0660, Euromedex), 40% glycerol (Cat#G9012 ...
-
bioRxiv - Genomics 2023Quote: ... Agarose soluble extract media (ASEM) was prepared by adding 2 g of Agarose D3 (Euromedex) to a 5 g/L solution of Tryptone media (Bacto™) ...
-
bioRxiv - Genomics 2023Quote: ... at 37 °C for 2 hours and with 8 μL of proteinase K (Euromedex, 09-0911) at 56 °C for 2 hours to complete the lysis ...
-
bioRxiv - Microbiology 2020Quote: ... 1μL was then spotted on LB media supplemented with 40 μg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) (Euromedex), ampicillin (Amp ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were probed with the following antibodies overnight at 4°C under stirring: anti-hDICER (1:1000, A301-937A, Euromedex, Bethyl), anti-PKR (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were incubated in an appropriate buffer solution at pH6 containing bromo-4-chloro-3-indolyl-β-D-galactopyranoside (Euromedex, Souffelweyersheim, France), as described previously (Gorwood ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... neurons were fixed for 20 min at RT in D-PBS containing 4% (w/v) paraformaldehyde (PFA) (Euromedex #15714-S, Souffelweyersheim, France) and 4% (w/v ...
-
bioRxiv - Systems Biology 2023Quote: ... The strains were grown in liquid SC medium (Yeast Nitrogen Base with ammonium sulfate 6.7 g.l−1, MPbio, OH, USA; amino acid mixture 2 g.l−1, MPbio; glucose 20 g.l−1, Euromedex, France). The culture was maintained until the strains reached their growth mid log phase using an optical plate reader (Tecan infinite F200 pro) ...
-
bioRxiv - Microbiology 2023Quote: ... mice received an IP injection of 2 mg of MAR1-5A3 anti-IFNAR antibody (Euromedex, Cat#BX-BE0241) one day prior infection ...
-
bioRxiv - Microbiology 2021Quote: ... The mixture (2.5 µL) was deposited on the surface of 1 mL of tryptone-NaCl medium solidified with 2% agarose D3 (Euromedex) poured in 2 mL micro tubes and incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... The mixture (2.5 µL) was deposited on the surface of 1 mL of tryptone-NaCl medium solidified with 2% agarose D3 (Euromedex) poured in 2 mL micro tubes or in wells of 24-well plates and incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... The mixture (2.5 µL) was deposited on the surface of 1 mL of tryptone-NaCl medium solidified with 2% agarose D3 (Euromedex) poured in 2 mL microtubes or in wells of 24-well plates and incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... Yeasts were washed once in SPM buffer and incubated for 1 h at 30°C in 1 mL of a solution containing 2 mg of Zymolyase 20T (Euromedex®), 100 mg of lysing enzymes from Trichoderma harzianum (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... The muMECs were seeded in T75 tissue culture flasks pre-coated with gelatin-based coating solution for 2 min (from Cell Biologics, Euromedex) and cultures were divided twice a week or as necessary ...
-
bioRxiv - Microbiology 2021Quote: Gene encoding TurboFP650 was amplified from the plasmid pTurboFP650-N (Evrogen, Euromedex, France) with primers TurboFP650-XbaI 5’TGCTCTTAGATTTAAGAAGGAGATATAGATATGGGAGAGGATAGCGAGCTG3’ and TurboFP650-SphI 5’CATGCATGCTTAGCTGTGCCCCAGTTTGCTAGG3’ ...
-
bioRxiv - Genomics 2023Quote: ... the slides were immersed in 5X SSC solution overnight (O/N) at RT (Euromedex, EU0300-C). The following day ...
-
bioRxiv - Microbiology 2021Quote: ... before being transferred overnight on a nylon Hybond N+ membrane (Cytiva) in a 20X SSC solution (Euromedex). RNAs were UV crosslinked (120 mJoules ...
-
bioRxiv - Immunology 2023Quote: ... and purified Tregs at a ratio 1:1 in 96-well plates pre-coated with gelatin-based coating solution (from Cell Biologics, Euromedex).