Labshake search
Citations for Euromedex :
1 - 11 of 11 citations for Mouse BNIP2 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (1:1000; 2A3, Euromedex) rabbit anti-Calnexin (1:1000 ...
-
bioRxiv - Microbiology 2021Quote: Gene encoding TurboFP650 was amplified from the plasmid pTurboFP650-N (Evrogen, Euromedex, France) with primers TurboFP650-XbaI 5’TGCTCTTAGATTTAAGAAGGAGATATAGATATGGGAGAGGATAGCGAGCTG3’ and TurboFP650-SphI 5’CATGCATGCTTAGCTGTGCCCCAGTTTGCTAGG3’ ...
-
bioRxiv - Microbiology 2019Quote: ... BACTH plasmids were made using the Euromedex BACTH System Kit (Euromedex Cat. No. EUK001).
-
bioRxiv - Cell Biology 2022Quote: ... and mouse anti-actin (1:5000; ACT-2D7, Euromedex).
-
bioRxiv - Cell Biology 2019Quote: ... and mouse anti-α-tubulin (1:5000, GT114, Cat. #GTX628802, Euromedex). Alexa Fluor conjugated secondary antibodies used ...
-
bioRxiv - Microbiology 2022Quote: ... and plasmids verified by sequencing before BACTH assays (76) were set up according to the manufacturer (Euromedex). Co-transformation of plasmids containing fusion-genes of opposite domains ...
-
bioRxiv - Cancer Biology 2019Quote: RNA was extracted from homogenized mouse organs or from cells using TRIzol reagent (Euromedex) following the standard protocol ...
-
bioRxiv - Microbiology 2023Quote: ... was used to transfect plasmids into low passage HeLa cells with selection being performed using G418 at 800ng/mL (Euromedex, #EU0601) for 7 days ...
-
bioRxiv - Immunology 2023Quote: ... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
bioRxiv - Physiology 2023Quote: ... genomic DNA was isolated from mouse tail snip using lysis buffer Tris-HCl (EuroMedex, 26-128-3094-B) pH8.5 100mM ...
-
bioRxiv - Immunology 2023Quote: ... composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics, Euromedex) containing fetal bovine serum ...