Labshake search
Citations for Euromedex :
1 - 14 of 14 citations for L Phenylalanine N T Boc 13C9 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 0.4 g/L L-cystein HCl (Euromedex), 0.25 g/L ...
-
bioRxiv - Physiology 2023Quote: ... N-(2-Hydroxyethyl)piperazine-N′-(2-ethanesulfonic acid) (HEPES-KOH pH 7.4 20 mM; EuroMedex, 10-110); Sucrose 110mM ...
-
bioRxiv - Biochemistry 2021Quote: ... The ParAF and ParBF preparations were pure to > 97% homogeneity as judged by SDS-PAGE stained by Instant Blue (Euromedex). An example of ParAF purification was shown in Supplementary Figure S1A.
-
bioRxiv - Cancer Biology 2021Quote: ... and 250 ng of Pd(N)6 random hexamers (Euromedex PM-301L). Real-time qPCR of reversed transcribed RNAs was run with SYBR® Green Master Mix (Biorad ...
-
bioRxiv - Microbiology 2021Quote: Gene encoding TurboFP650 was amplified from the plasmid pTurboFP650-N (Evrogen, Euromedex, France) with primers TurboFP650-XbaI 5’TGCTCTTAGATTTAAGAAGGAGATATAGATATGGGAGAGGATAGCGAGCTG3’ and TurboFP650-SphI 5’CATGCATGCTTAGCTGTGCCCCAGTTTGCTAGG3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were blocked in a solution containing 5% skimmed milk in TBS-T (TBS [Euromedex, ET220] containing 0.1% Tween [Euromedex ...
-
bioRxiv - Genomics 2023Quote: ... the slides were immersed in 5X SSC solution overnight (O/N) at RT (Euromedex, EU0300-C). The following day ...
-
bioRxiv - Microbiology 2021Quote: ... before being transferred overnight on a nylon Hybond N+ membrane (Cytiva) in a 20X SSC solution (Euromedex). RNAs were UV crosslinked (120 mJoules ...
-
bioRxiv - Plant Biology 2019Quote: ... The medium contained 10 g L−1 of purified agar (Euromedex, https://web.euromedex.com/) and 0.5 mM MgSO4 ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed three times using PBS-T (PBS 1X + 0,1% Triton X-100 + 0,02% Sodium Azide) and incubated with PBS-T + BSA (04-100-812-C from Euromedex) 1% for 30 min at RT ...
-
bioRxiv - Developmental Biology 2020Quote: ... which was blocked for 30 min and incubated with primary antibody in 5% nonfat dry milk in TBS-T (20 mM Tris base (Cat#26-128-3094-B, Euromedex), 150 mM NaCl ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were blocked in a solution containing 5% skimmed milk in TBS-T (TBS [Euromedex, ET220] containing 0.1% Tween [Euromedex, 2001-B]) and incubated overnight at 4°C with primary antibodies diluted in the blocking solution ...
-
bioRxiv - Bioengineering 2023Quote: ... Minimal YNB medium contained 1.7 g/L yeast nitrogen base without amino acids and nitrogen (Euromedex) and 5 g/L ammonium sulphate ...
-
bioRxiv - Bioengineering 2023Quote: ... Yeast cells were transformed using the yeast transformation procedure described in [14] and selected on YNB Acetamide plates (1.7 g/L yeast nitrogen base without amino acids and nitrogen (Euromedex), 6.6 g/L K2SO4 ...