Labshake search
Citations for Euromedex :
1 - 30 of 30 citations for Glycine N Fmoc 2 13C 99%;15N 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... N-(2-Hydroxyethyl)piperazine-N′-(2-ethanesulfonic acid) (HEPES-KOH pH 7.4 20 mM; EuroMedex, 10-110); Sucrose 110mM ...
-
bioRxiv - Microbiology 2023Quote: ... using wet transfer with tris-glycine-methanol buffer (milli-Q H2O supplemented with 15% methanol and 10% 10X Tris-glycine solution, Euromedex). Then ...
-
bioRxiv - Plant Biology 2021Quote: ... Proteins were transferred on nitrocellulose membrane 0.45 μm in 1xTris-Glycine (Euromedex®), 20%EtOH transfer buffer at 100 V for 1h ...
-
A quantitative tri-fluorescent yeast two-hybrid system: from flow cytometry to in-cellula affinitiesbioRxiv - Biochemistry 2019Quote: ... and one incubation of 15min at 4°C in 500µl of PBS 0.1M Glycine (Euromedex). Finally ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were separated by migration at 135 V in 1X Tris-Glycine-SDS buffer (Euromedex). Proteins were electro-transferred on a nitrocellulose membrane in 1X Tris-Glycine buffer supplemented with 20% ethanol ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples migrated on 7.5% (for proteins over 200kDa) or 10% SDS-PAGE polyacrylamide gel at 140V with 1xTris-Glycine SDS running buffer (Euromedex®). Proteins were transferred on nitrocellulose membrane 0.45 μm in 1xTris-Glycine (Euromedex®) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 250 ng of Pd(N)6 random hexamers (Euromedex PM-301L). Real-time qPCR of reversed transcribed RNAs was run with SYBR® Green Master Mix (Biorad ...
-
bioRxiv - Microbiology 2021Quote: Gene encoding TurboFP650 was amplified from the plasmid pTurboFP650-N (Evrogen, Euromedex, France) with primers TurboFP650-XbaI 5’TGCTCTTAGATTTAAGAAGGAGATATAGATATGGGAGAGGATAGCGAGCTG3’ and TurboFP650-SphI 5’CATGCATGCTTAGCTGTGCCCCAGTTTGCTAGG3’ ...
-
bioRxiv - Genomics 2023Quote: ... the slides were immersed in 5X SSC solution overnight (O/N) at RT (Euromedex, EU0300-C). The following day ...
-
bioRxiv - Microbiology 2021Quote: ... before being transferred overnight on a nylon Hybond N+ membrane (Cytiva) in a 20X SSC solution (Euromedex). RNAs were UV crosslinked (120 mJoules ...
-
bioRxiv - Microbiology 2023Quote: ... and 2% agarose D3 (Euromedex, France ...
-
bioRxiv - Developmental Biology 2020Quote: Vibratome sections were permeabilized and blocked with PBTA2 solution (2% BSA, 2% FBS, 1% Tween20 (Cat#2001-A, Euromedex) for 2h at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: Embryos were fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Developmental Biology 2019Quote: Embryos are fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: Embryos are fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were fixed with 2 % paraformaldehyde (PFA, EMS, Euromedex) in phosphate-buffered saline (PBS ...
-
bioRxiv - Developmental Biology 2023Quote: Embryos or doublets are fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Developmental Biology 2023Quote: Embryos in the inverse bleb phase were fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... Agarose soluble extract media (ASEM) was prepared by adding 2 g of Agarose D3 (Euromedex) to a 5 g/L solution of Tryptone media (Bacto™) ...
-
bioRxiv - Microbiology 2023Quote: ... Blue-fluorescent DNA stain 4’,6-diamidino-2-phenylindole (DAPI) was purchased from Euromedex (Souffelweyersheim, France). Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... at 37 °C for 2 hours and with 8 μL of proteinase K (Euromedex, 09-0911) at 56 °C for 2 hours to complete the lysis ...
-
bioRxiv - Microbiology 2024Quote: ... Blue-fluorescent DNA stain 4’,6-diamidino-2-phenylindole (DAPI) was purchased from Euromedex (Souffelweyersheim, France). Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... The strains were grown in liquid SC medium (Yeast Nitrogen Base with ammonium sulfate 6.7 g.l−1, MPbio, OH, USA; amino acid mixture 2 g.l−1, MPbio; glucose 20 g.l−1, Euromedex, France). The culture was maintained until the strains reached their growth mid log phase using an optical plate reader (Tecan infinite F200 pro) ...
-
bioRxiv - Microbiology 2023Quote: ... mice received an IP injection of 2 mg of MAR1-5A3 anti-IFNAR antibody (Euromedex, Cat#BX-BE0241) one day prior infection ...
-
bioRxiv - Microbiology 2021Quote: ... The mixture (2.5 µL) was deposited on the surface of 1 mL of tryptone-NaCl medium solidified with 2% agarose D3 (Euromedex) poured in 2 mL micro tubes and incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... The mixture (2.5 µL) was deposited on the surface of 1 mL of tryptone-NaCl medium solidified with 2% agarose D3 (Euromedex) poured in 2 mL micro tubes or in wells of 24-well plates and incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... The mixture (2.5 µL) was deposited on the surface of 1 mL of tryptone-NaCl medium solidified with 2% agarose D3 (Euromedex) poured in 2 mL microtubes or in wells of 24-well plates and incubated overnight at 37°C ...
-
Kinetochore individualization in meiosis I is required for centromeric cohesin removal in meiosis IIbioRxiv - Cell Biology 2020Quote: ... For whole-mount staining of stable spindle microtubules oocytes were incubated 2-6 min in a cold treatment solution (80mM PIPES (Euromedex, 1124), 1mM MgCl2 (Euromedex ...
-
bioRxiv - Microbiology 2019Quote: ... Yeasts were washed once in SPM buffer and incubated for 1 h at 30°C in 1 mL of a solution containing 2 mg of Zymolyase 20T (Euromedex®), 100 mg of lysing enzymes from Trichoderma harzianum (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... The muMECs were seeded in T75 tissue culture flasks pre-coated with gelatin-based coating solution for 2 min (from Cell Biologics, Euromedex) and cultures were divided twice a week or as necessary ...