Labshake search
Citations for Euromedex :
1 - 6 of 6 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... washed 1×5 min in 2xSSCT (2X Saline Sodium Citrate (Euromedex #EU0300-A) 0,1% Tween-20 (Sigma Aldrich #P1379 ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 1×5 min in 2xSSCT (2X Saline Sodium Citrate (Euromedex #EU0300-A) 0,1% Tween-20 (Sigma Aldrich #P1379 ...
-
bioRxiv - Biochemistry 2020Quote: ... Blots were washed two times at 42°C with 2X SSC buffer (Euromedex, Souffelweyersheim, France) with 0.1% SDS added ...
-
bioRxiv - Cell Biology 2023Quote: ... tissue sections were deparaffinized with Histo-clear II (Euromedex) and then rehydrated in successive baths of ethanol (100% ...
-
bioRxiv - Neuroscience 2023Quote: ... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1mM EDTA) and suspended in a mix of 90 µL TE buffer + 10 µL lysostaphin 35520 U/ml (EUROMEDEX) + 2,5 µL RNasin Plus 40 U/µl (Promega) ...