Labshake search
Citations for Euromedex :
1 - 12 of 12 citations for Dengue Virus serotype 3 lysate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and 3% BSA (Euromedex). A horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (Abcam ...
-
bioRxiv - Microbiology 2020Quote: ... 100 mM NaCl and 1% CHAPS (3-[(3-cholamidopropyl) diméthylammonio]-1-propanesulfonate (Euromedex). The supernatant was cleared by centrifugation at 53 000 g for 30 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
bioRxiv - Cell Biology 2021Quote: ... Mice received 3 mg of tamoxifen free base (Euromedex) by intraperitoneal injection two days prior to intravital imaging.
-
bioRxiv - Microbiology 2021Quote: ... Cell lysates were incubated for 4 h at 4°C with an anti-Flag antibody coupled to agarose beads (Euromedex). The beads were then washed 3 times with lysis buffer and 1 time with PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... wells were washed twice with 3% bovine serum albumin (Euromedex, Souffelweyersheim, France) in PBS ...
-
bioRxiv - Immunology 2019Quote: ... a blocking step with 100 μl of 3% bovine serum albumin (BSA) (Euromedex) in PBS was performed for 30 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3 times for 5 min in PBS and permeabilized with 0.1% Triton X-100 and 0.02% SDS (Euromedex, EU0660) in PBS for 5 min ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... Organoids were then washed with PBS for 3 times for 5 min each and stored in 1:1 ratio PBS and glycerol (Euromedex 15710) before imaging ...
-
bioRxiv - Microbiology 2020Quote: ... 1μL was then spotted on LB media supplemented with 40 μg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) (Euromedex), ampicillin (Amp ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were incubated in an appropriate buffer solution at pH6 containing bromo-4-chloro-3-indolyl-β-D-galactopyranoside (Euromedex, Souffelweyersheim, France), as described previously (Gorwood ...