Labshake search
Citations for Omega Bio-Tek :
1 - 18 of 18 citations for Human Immunodeficiency Virus Reverse Transcriptase Protein HIV 1 Clade B IIIB since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: Total nucleic acids were extracted using the HP Virus DNA/RNA Kit (R6873; Omega Bio-Tek, Norcross, USA), and carrier RNA was not used during the process to avoid potential interference with sequencing results ...
-
bioRxiv - Genetics 2021Quote: ... and DNA was then extracted from the liberated occlusion-derived virus particles using a DNA isolation kit (Omega Bio-tek) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: Fluorophore-labeled DNA was generated using PCR amplification with a 5’FAM-labeled reverse primer (IDT) and an unlabelled forward primer and purified using the E.Z.N.A Gel Extraction Kit (Omega Bio-tek). The amplified region contained the 256-bp region directly upstream of the lldA start codon ...
-
bioRxiv - Genomics 2022Quote: ... cfDNA was then extracted from human blood plasma by using the Mag-Bind cfDNA Kit (Omega Bio-Tek). The protocol was optimized and modified to optimize yield28 ...
-
bioRxiv - Immunology 2022Quote: Total genomic DNA was extracted from human fecal samples using the E.Z.N.A.® DNA Kit (Omega Bio-tek, Norcross, GA, U.S.) as manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: Total microbial genomic DNA was extracted from fecal samples of humans and mice using the E.Z.N.A.® DNA Kit (Omega Bio-Tek, Norcross, GA, U.S.) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... Protocol 1: EZNA Tissue DNA KIT (Omega Bio-Tek, USA); Protocol 2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were harvested in 1 mL RNA-Solv Reagent (Omega Bio-Tek) for RNA isolation.
-
bioRxiv - Microbiology 2020Quote: ... 100-bp and 1-kb molecular ladders (Omega Bio-tek, Norcross, GA, USA) were also added to gels ...
-
bioRxiv - Genetics 2023Quote: ... 1 µL dNTP mix (2mM each dNTP, OMEGA BIO-TEK, Cat#101414-958), 1U Choice Taq (Denville Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... For RNA extraction cells were harvested with 1 ml RNAsolv reagent (Omega Bio-Tek) per 6 well and RNA was isolated according to manufacturer’s instruction ...
-
bioRxiv - Genetics 2021Quote: ... PCR amplified products were purified from 1% agarose gel using E.Z.N.A Gel Extraction Kit (Omega Bio-Tek, Norcross, GA). Sanger sequencing was used to verify successful deletion of the target region ...
-
bioRxiv - Molecular Biology 2020Quote: ... then PCR products of ~1 kb were recovered from an agarose gel using an OMEGA gel-purification kit (OMEGA Bio-tek). The purified DNA fragments were cloned into pJET1.2 (CloneJET PCR Cloning Kit ...
-
bioRxiv - Microbiology 2020Quote: Nasal swabs where taken from two adult healthy volunteers using STX 764 sterile small polyester swabs (Texwipe) and immediately stirred for 30 seconds in 1 ml of TRK lysis buffer (Omega Bio-tek). One volume of 70% EtOH was added ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from GBM-DCs and TRA-1-81+/SSEA4+ ic-GSCs using the EZNA Total RNA Kit (R6834-01 Omega Bio-Tek). Quality control ...
-
bioRxiv - Microbiology 2023Quote: ... dissected body parts or tissues were homogenized in either 200 µl DMEM medium for end-point titration on BHK-21 cells or in 1 mL RNA-Solv reagent (Omega Bio-Tek) for RNA isolation ...
-
bioRxiv - Microbiology 2020Quote: ... The pellet of synchronized worms (L2) was treated with 4 mm steel beads and 1 mL of RNA-Solv® Reagent (Omega Bio-Tek). The mix was vortexed for 5 minutes ...