Labshake search
Citations for Omega Bio-Tek :
1 - 45 of 45 citations for Anti Flag Affinity Gel since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... gel purified with E.Z.N.A Gel Extraction Kit (Omega Bio-tek) and Sanger sequenced using primers used for PCR ...
-
bioRxiv - Bioengineering 2020Quote: ... and then agarose-gel-purified products (Omega Bio-Tek E.Z.N.A gel extraction kit) were cloned into the open-reading frame of an expression vector (pET14b) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The libraries were gel-purified using the E.Z.N.A Gel Extraction Kit (Omega Bio-Tek). Sequencing was performed using a HiSeq 4000 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... both insert and vector were gel-purified using MicroElute Gel Extraction Kit (Omega Bio-Tek, Inc.) following manufacturer’s instructions prior to ligation ...
-
bioRxiv - Cancer Biology 2019Quote: ... Gel Extraction Kit (Omega Bio-tek). Deep sequencing libraries were generated by PCR amplification of sgRNA cassettes using sgRNA_P5_seq ...
-
bioRxiv - Biochemistry 2021Quote: ... Gel Extraction Kit (Omega Bio-tek) after agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2021Quote: ... Gel Extraction Kit (Omega Bio-tek) after agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2021Quote: ... Gel Extraction Kit (Omega Bio-tek) after agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2021Quote: ... Gel Extraction Kit (Omega Bio-tek) after agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2021Quote: ... Gel Extraction Kit (Omega Bio-tek) after agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2023Quote: ... Gel Extraction Kit (Omega Bio-Tek) or the ExoSAP-IT PCR Cleanup Reagent (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... ™ Gel Extraction Kit (Omega Bio-Tek). Linear replicon DNA (500 ng ...
-
bioRxiv - Genetics 2021Quote: ... PCR amplified products were purified from 1% agarose gel using E.Z.N.A Gel Extraction Kit (Omega Bio-Tek, Norcross, GA). Sanger sequencing was used to verify successful deletion of the target region ...
-
bioRxiv - Bioengineering 2020Quote: ... Purification of DNA fragments from agarose gels used the MicroElute® Gel Extraction Kit (OMEGA Bio-tek, #D6294-02). DNA concentration was quantified by UV absorbance with the SpectraMax M3 microplate reader using a SpectraDrop Micro-Volume Microplate (Molecular Devices) ...
-
bioRxiv - Microbiology 2020Quote: ... The amplified product was run on 2% agarose gel and purified by OMEGA Gel purification Kit (OMEGA Bio-Tek). Next ...
-
bioRxiv - Molecular Biology 2020Quote: ... then PCR products of ~1 kb were recovered from an agarose gel using an OMEGA gel-purification kit (OMEGA Bio-tek). The purified DNA fragments were cloned into pJET1.2 (CloneJET PCR Cloning Kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... The efficiency of primer extension was confirmed on a 1.5% agarose gel and the extended dsDNA were further purified by a Gel Extraction Kit (Omega Bio-Tek). The pre-melted DNA templates were prepared by the same procedure using tDNA primer with non-complementary sequences at the specified positions (Figs 3G ...
-
bioRxiv - Molecular Biology 2022Quote: Each of the targeted PCR amplicons obtained from the aforementioned genomic DNA templates was recovered from agarose gels using a Gel Extraction Kit (Omega Bio-Tek) and purified using a Universal DNA Purification kit (TIANGEN ...
-
bioRxiv - Biochemistry 2023Quote: ... the samples were diluted 500 times and filtered using the DNA Mini columns with a nucleic acid-affinity membrane (Omega Bio-tek.) to decrease or remove the nucleic acid in samples ...
-
bioRxiv - Genomics 2020Quote: ... purified with E.Z.N.A Gel Extraction Kit (Omega Bio-tek), transformed into chemically competent HB101 E.coli ...
-
bioRxiv - Cancer Biology 2019Quote: ... Gel Extraction Kit (Omega Bio-Tek, Cat. # D2500-02). 200 ng of purified PCR product were denatured and re-annealed in NE Buffer 2 (New England BioLabs ...
-
bioRxiv - Microbiology 2022Quote: ... Gel Extraction Kit (Omega Bio-Tek, Norcross, GA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Gel extraction kit (Omega Bio-tek, Inc. Norcross, USA). The spin column was loaded with 20µl PCR sample mixed with 20µl binding buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Gel Extraction kit (Omega Bio-tek Inc., Georgia, USA) and cloned into the pGEM-T easy vector (Promega ...
-
bioRxiv - Physiology 2022Quote: ... Gel Extraction Kit (Omega bio-tek, Inc, Norcross, GA, USA). slc15a2b was cloned into a StrataClone blunt PCR cloning vector pSC-B (Agilent Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA was purified (Gel Extraction Kit; Omega Bio-Tek, Norcross, GA) and validated via Sanger sequencing.
-
bioRxiv - Cell Biology 2020Quote: ... and purified using E.N.Z.A.® Gel Extraction Kit (Omega Bio-Tek, D2500-01). Linearized pShuttle-CMV plasmids were transformed into the final viral backbone using electrocompetent AdEasier-1 cells (Addgene ...
-
bioRxiv - Microbiology 2020Quote: ... gel extraction kit and DNA purification kit were obtained from Omega Bio-tek, Inc ...
-
bioRxiv - Plant Biology 2022Quote: ... The products were purified using E.Z.N.A.® Gel extraction kit (Omega Bio-Tek) and inserted into a pCR8 vector ...
-
bioRxiv - Bioengineering 2019Quote: ... PCR Purification and Gel Extraction Kits were obtained from Omega Bio-tek (Norcross, GA). Mouse-anti-His6 primary antibody and goat anti-mouse IgG H&L (Alexa Fluor® 488 ...
-
bioRxiv - Microbiology 2022Quote: ... For DNA purification and gel extractions the E.Z.N.A.® Cycle-Pure Kit (Omega Bio-Tek) and illustra™ GFX™ PCR DNA and Gel Band Purification Kit (GE Healthcare Life Sciences ...
-
bioRxiv - Plant Biology 2024Quote: ... The PCR products were gel purified using the E.Z.N.A® Cycle-Pure Kit (Omega Bio-tek) and sequenced at Macrogen (Amsterdam).
-
bioRxiv - Biochemistry 2021Quote: ... and PCR products were purified using an E.Z.N.A.® Gel Extraction Kit (Omega Bio-tek, Inc., USA). Target DNA fragment(s ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were purified using the EZNA® Gel Extraction Kit (Omega Bio-Tek, Doraville, USA). Sequencing libraries were generated using NEBNext® Ultra™ DNA Library Prep Kit for Illumina® (New England Biolabs ...
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... followed by gel electrophoresis and purification of the correct sized band of linearised plasmid with E.Z.N.A Gel Extraction Kit (Omega Bio-tek). The resulting linearised plasmid and double stranded oligonucleotides were ligated using Gibson Assembly Master Mix (NEB ...
-
bioRxiv - Microbiology 2024Quote: Fluorophore-labeled DNA was generated using PCR amplification with a 5’FAM-labeled reverse primer (IDT) and an unlabelled forward primer and purified using the E.Z.N.A Gel Extraction Kit (Omega Bio-tek). The amplified region contained the 256-bp region directly upstream of the lldA start codon ...
-
bioRxiv - Biochemistry 2021Quote: ... to clean up templates at 37 °C for 2.5 hours and then purified by gel-extraction following the manufacturer instructions (Cat# D2500-02, OMEGA Bio-tek). Then 50 to 100 ng purified vector was added to 15 μL of the Gibson master mix prior to adding purified insert to the mix at a molar ratio of 3:1 insert per vector (a ratio of 7:1 was used when the insert was less than 500 bp) ...
-
bioRxiv - Biophysics 2021Quote: ... Near 1250 bp regions of double-stranded products of protected digestion of rolling circle amplification were inserted into modified pET14b backbones were selected by agarose-gel-cutting and purified by Omega Bio-Tek E.Z.N.A ...
-
bioRxiv - Synthetic Biology 2021Quote: ... all products were run on a 2 w/v% agarose gel to verify successful amplification of target and then purified using a PCR purification kit (Omega Bio-Tek). The prepared linear DNA was either directly used in cell-free and cell-free ATPS reactions or used as a template for in vitro transcription.
-
bioRxiv - Cell Biology 2022Quote: ... PCR products were fluorescently labeled at the 5′ ends with Cy5 (Yingjun Corp. China) and purified by gel extraction (OMEGA Bio-TEK). Fluorescently-labeled DNA was then detected using a Biophotometer Plus (Eppendorf ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Amplified DNA was run on a 2% agarose gel and were excised and purified using the MicroElute Cycle-Pure Kit (Omega Bio-Tek). Purified DNA was Sanger sequenced by Cornell Institute of Biotechnology ...
-
bioRxiv - Zoology 2019Quote: ... Three replicates of the PCR reactions for each sample were combined and the PCR products were purified using Gel Extraction Kit (Omega Bio-Tek, USA). DNA was quantified using Qubit@ 2.0 Fluorometer (Thermo Scientific) ...
-
bioRxiv - Synthetic Biology 2023Quote: The pDNA production obtained with the different strains was evaluated by extracting the pDNA with the MicroElute Gel Extraction Kit (Omega Bio-Tek, Inc.) and quantifying it with Qubit Invitrogen (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... the PCR products were evaluated by electrophoresis in 1.5% agarose gel and purified with the Mag-Bind RxnPure Plus kit (Omega Bio-Tek, CA, Norcross, GA, USA) by mixing 20 μL of amplicon with 25 μL of Mag-Bind in a 96 well flat-bottom micro-titer plate ...