Labshake search
Citations for Omega Bio-Tek :
1 - 21 of 21 citations for 7H Pyrrolo 2 3 d pyrimidin 2 amine 7 3 5 bis O 2 4 dichlorophenyl methyl 2 C methyl b D ribofuranosyl 4 chloro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: RNA was extracted from isolated clinical SARS-CoV-2 with E.Z.N.A total RNA (Omega Bio-Tek). Maxima H Minus cDNA Synthesis (Thermofisher ...
-
bioRxiv - Microbiology 2020Quote: ... The amplified product was run on 2% agarose gel and purified by OMEGA Gel purification Kit (OMEGA Bio-Tek). Next ...
-
bioRxiv - Microbiology 2023Quote: ... and 0.25 ml was immediately transferred to 2 ml disruptor tubes (Omega Bio-Tek E.Z.N.A Soil DNA; Norcross GA), then stored at -80ºC until DNA extraction ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the protein was eluted with six column volumes of 0-100% gradient of elution buffer (binding buffer with 500 mM imidazole) and 2 ml fractions were collected into 96 deep well plates (Omega Bio-tek). The collected fractions were run on SDS-PAGE gel and the fractions corresponding to His10-SUMO-RelA with the least nucleic acid contamination was collected (≈5 ml ...
-
bioRxiv - Synthetic Biology 2021Quote: ... all products were run on a 2 w/v% agarose gel to verify successful amplification of target and then purified using a PCR purification kit (Omega Bio-Tek). The prepared linear DNA was either directly used in cell-free and cell-free ATPS reactions or used as a template for in vitro transcription.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Amplified DNA was run on a 2% agarose gel and were excised and purified using the MicroElute Cycle-Pure Kit (Omega Bio-Tek). Purified DNA was Sanger sequenced by Cornell Institute of Biotechnology ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was obtained from all BEC lines (3 Ctrl BEC and 5 SZP BEC) by phenol-chloroform extraction using RNAsolv (Omega Bio-Tek, Norcross, GA, USA). 1 μg of RNA was treated with DNase I (Invitrogen ...
-
bioRxiv - Zoology 2020Quote: Whole genomic DNA was extracted from either the whole specimen or pereopods 5–7 using an EZNA Tissue Kit (Omega Bio-tek Inc.) following the manufacturer’s protocols ...
-
bioRxiv - Genetics 2021Quote: ... DNA was extracted from the CRISPR-cas9 targeted Calu-3 cells using E.Z.N.A Tissue DNA Kit (Omega Bio-Tek, Norcross, GA), and the ACE2 regulatory element/sub-element region was amplified using PCR primers flanking each sgRNA location (listed in Table S2) ...
-
bioRxiv - Plant Biology 2019Quote: Total RNA was extracted from basal internodes of 4-week-old plants using Omega Plant RNA Mini Kit (Omega Bio-Tek). About 500 ng DNAse treated RNA was used for cDNA synthesis using qScript cDNA supermix (Quanta BioSciences) ...
-
bioRxiv - Microbiology 2020Quote: ... The pellet of synchronized worms (L2) was treated with 4 mm steel beads and 1 mL of RNA-Solv® Reagent (Omega Bio-Tek). The mix was vortexed for 5 minutes ...
-
bioRxiv - Evolutionary Biology 2020Quote: Whole genomic DNA was extracted from either the whole specimen or pereopods 6–7 depending on the size of the amphipod using an EZNA Tissue DNA kit (Omega Bio-tek Inc.) following manufacturer’s protocols ...
-
bioRxiv - Bioengineering 2022Quote: ... The suspension was then digested at 56 °C with proteinase K (Omega Bio-tek, Atlanta, GA, USA) for approximately 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial colonies were selected and grown in LB containing 50 µg/ml kanamycin A at 30°C for 24 hours and plasmid DNA were purified using the E.Z.N.A Plasmid Mini Extraction kit (Omega Bio-tek) based on the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... to clean up templates at 37 °C for 2.5 hours and then purified by gel-extraction following the manufacturer instructions (Cat# D2500-02, OMEGA Bio-tek). Then 50 to 100 ng purified vector was added to 15 μL of the Gibson master mix prior to adding purified insert to the mix at a molar ratio of 3:1 insert per vector (a ratio of 7:1 was used when the insert was less than 500 bp) ...
-
bioRxiv - Zoology 2022Quote: ... the membrane was stored at −80 °C for extraction of bacterial DNA genome with an E.Z.N.ATM Mag-Bind Soil DNA Kit (OMEGA Bio-Tek, Inc., GA, USA), according to the manufacturers’ instructions.
-
bioRxiv - Zoology 2021Quote: ... Samples were stored at -80°C until DNA was extracted DNA using Omega Bio-tek Mag-Bind Blood & Tissue DNA HDQ Kits (Omega Bio-tek, #M6399-01) with a manufacturer-designed protocol for the Kingfisher Duo Prime (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted in biological triplicate per condition (0.03% and 5% CO2) using the E.Z.N.A.™ Yeast RNA Kit (Omega Bio-Tek, R6870-01) as per the manufacturer’s instructions with a few modifications ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR products were fluorescently labeled at the 5′ ends with Cy5 (Yingjun Corp. China) and purified by gel extraction (OMEGA Bio-TEK). Fluorescently-labeled DNA was then detected using a Biophotometer Plus (Eppendorf ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted from 5 mg of spleen lysate using the Omega Biotek Total RNA 96 kit (Omega Bio-Tek, Norcross, GA) and a KingFisher Flex Instrument (ThermoFisher Scientific ...