Labshake search
Citations for Omega Bio-Tek :
1 - 23 of 23 citations for 7 Methyl 1 2 3 4 tetrahydroisoquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The pellet of synchronized worms (L2) was treated with 4 mm steel beads and 1 mL of RNA-Solv® Reagent (Omega Bio-Tek). The mix was vortexed for 5 minutes ...
-
bioRxiv - Evolutionary Biology 2020Quote: Whole genomic DNA was extracted from either the whole specimen or pereopods 6–7 depending on the size of the amphipod using an EZNA Tissue DNA kit (Omega Bio-tek Inc.) following manufacturer’s protocols ...
-
bioRxiv - Zoology 2020Quote: Whole genomic DNA was extracted from either the whole specimen or pereopods 5–7 using an EZNA Tissue Kit (Omega Bio-tek Inc.) following the manufacturer’s protocols ...
-
bioRxiv - Genetics 2021Quote: ... DNA was extracted from the CRISPR-cas9 targeted Calu-3 cells using E.Z.N.A Tissue DNA Kit (Omega Bio-Tek, Norcross, GA), and the ACE2 regulatory element/sub-element region was amplified using PCR primers flanking each sgRNA location (listed in Table S2) ...
-
bioRxiv - Microbiology 2022Quote: RNA was extracted from isolated clinical SARS-CoV-2 with E.Z.N.A total RNA (Omega Bio-Tek). Maxima H Minus cDNA Synthesis (Thermofisher ...
-
bioRxiv - Plant Biology 2019Quote: Total RNA was extracted from basal internodes of 4-week-old plants using Omega Plant RNA Mini Kit (Omega Bio-Tek). About 500 ng DNAse treated RNA was used for cDNA synthesis using qScript cDNA supermix (Quanta BioSciences) ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was obtained from all BEC lines (3 Ctrl BEC and 5 SZP BEC) by phenol-chloroform extraction using RNAsolv (Omega Bio-Tek, Norcross, GA, USA). 1 μg of RNA was treated with DNase I (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... The amplified product was run on 2% agarose gel and purified by OMEGA Gel purification Kit (OMEGA Bio-Tek). Next ...
-
bioRxiv - Microbiology 2023Quote: ... and 0.25 ml was immediately transferred to 2 ml disruptor tubes (Omega Bio-Tek E.Z.N.A Soil DNA; Norcross GA), then stored at -80ºC until DNA extraction ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the protein was eluted with six column volumes of 0-100% gradient of elution buffer (binding buffer with 500 mM imidazole) and 2 ml fractions were collected into 96 deep well plates (Omega Bio-tek). The collected fractions were run on SDS-PAGE gel and the fractions corresponding to His10-SUMO-RelA with the least nucleic acid contamination was collected (≈5 ml ...
-
bioRxiv - Synthetic Biology 2021Quote: ... all products were run on a 2 w/v% agarose gel to verify successful amplification of target and then purified using a PCR purification kit (Omega Bio-Tek). The prepared linear DNA was either directly used in cell-free and cell-free ATPS reactions or used as a template for in vitro transcription.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Amplified DNA was run on a 2% agarose gel and were excised and purified using the MicroElute Cycle-Pure Kit (Omega Bio-Tek). Purified DNA was Sanger sequenced by Cornell Institute of Biotechnology ...
-
bioRxiv - Genomics 2019Quote: ... Protocol 1: EZNA Tissue DNA KIT (Omega Bio-Tek, USA); Protocol 2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were harvested in 1 mL RNA-Solv Reagent (Omega Bio-Tek) for RNA isolation.
-
bioRxiv - Microbiology 2020Quote: ... 100-bp and 1-kb molecular ladders (Omega Bio-tek, Norcross, GA, USA) were also added to gels ...
-
bioRxiv - Genetics 2023Quote: ... 1 µL dNTP mix (2mM each dNTP, OMEGA BIO-TEK, Cat#101414-958), 1U Choice Taq (Denville Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... For RNA extraction cells were harvested with 1 ml RNAsolv reagent (Omega Bio-Tek) per 6 well and RNA was isolated according to manufacturer’s instruction ...
-
bioRxiv - Genetics 2021Quote: ... PCR amplified products were purified from 1% agarose gel using E.Z.N.A Gel Extraction Kit (Omega Bio-Tek, Norcross, GA). Sanger sequencing was used to verify successful deletion of the target region ...
-
bioRxiv - Molecular Biology 2020Quote: ... then PCR products of ~1 kb were recovered from an agarose gel using an OMEGA gel-purification kit (OMEGA Bio-tek). The purified DNA fragments were cloned into pJET1.2 (CloneJET PCR Cloning Kit ...
-
bioRxiv - Microbiology 2020Quote: Nasal swabs where taken from two adult healthy volunteers using STX 764 sterile small polyester swabs (Texwipe) and immediately stirred for 30 seconds in 1 ml of TRK lysis buffer (Omega Bio-tek). One volume of 70% EtOH was added ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from GBM-DCs and TRA-1-81+/SSEA4+ ic-GSCs using the EZNA Total RNA Kit (R6834-01 Omega Bio-Tek). Quality control ...
-
bioRxiv - Microbiology 2023Quote: ... dissected body parts or tissues were homogenized in either 200 µl DMEM medium for end-point titration on BHK-21 cells or in 1 mL RNA-Solv reagent (Omega Bio-Tek) for RNA isolation ...