Labshake search
Citations for Omega Bio-Tek :
1 - 9 of 9 citations for 7 Fluoro 1H indazole 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... nucleic acid extracts were cleaned with Mag-Bind® TotalPure NGS beads (Omega Bio-Tek, USA) following Child et al. ...
-
bioRxiv - Evolutionary Biology 2020Quote: Whole genomic DNA was extracted from either the whole specimen or pereopods 6–7 depending on the size of the amphipod using an EZNA Tissue DNA kit (Omega Bio-tek Inc.) following manufacturer’s protocols ...
-
bioRxiv - Zoology 2020Quote: Whole genomic DNA was extracted from either the whole specimen or pereopods 5–7 using an EZNA Tissue Kit (Omega Bio-tek Inc.) following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2024Quote: Total nucleic acids were extracted using the HP Virus DNA/RNA Kit (R6873; Omega Bio-Tek, Norcross, USA), and carrier RNA was not used during the process to avoid potential interference with sequencing results ...
-
bioRxiv - Microbiology 2020Quote: ... Nucleic acid purification was performed using Mag-Bind® TotalPure NGS beads (Omega Bio-Tek Inc, Norcross, GA, USA) following the recommended ratio of the NEBNext® kit ...
-
bioRxiv - Biochemistry 2023Quote: ... the samples were diluted 500 times and filtered using the DNA Mini columns with a nucleic acid-affinity membrane (Omega Bio-tek.) to decrease or remove the nucleic acid in samples ...
-
bioRxiv - Genetics 2021Quote: ... DNA was extracted from the CRISPR-cas9 targeted Calu-3 cells using E.Z.N.A Tissue DNA Kit (Omega Bio-Tek, Norcross, GA), and the ACE2 regulatory element/sub-element region was amplified using PCR primers flanking each sgRNA location (listed in Table S2) ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was obtained from all BEC lines (3 Ctrl BEC and 5 SZP BEC) by phenol-chloroform extraction using RNAsolv (Omega Bio-Tek, Norcross, GA, USA). 1 μg of RNA was treated with DNase I (Invitrogen ...