Labshake search
Citations for Omega Bio-Tek :
1 - 8 of 8 citations for 7 Bromo 5 fluoro 3 methyl 1H indole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Zoology 2020Quote: Whole genomic DNA was extracted from either the whole specimen or pereopods 5–7 using an EZNA Tissue Kit (Omega Bio-tek Inc.) following the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was obtained from all BEC lines (3 Ctrl BEC and 5 SZP BEC) by phenol-chloroform extraction using RNAsolv (Omega Bio-Tek, Norcross, GA, USA). 1 μg of RNA was treated with DNase I (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2020Quote: Whole genomic DNA was extracted from either the whole specimen or pereopods 6–7 depending on the size of the amphipod using an EZNA Tissue DNA kit (Omega Bio-tek Inc.) following manufacturer’s protocols ...
-
bioRxiv - Genetics 2021Quote: ... DNA was extracted from the CRISPR-cas9 targeted Calu-3 cells using E.Z.N.A Tissue DNA Kit (Omega Bio-Tek, Norcross, GA), and the ACE2 regulatory element/sub-element region was amplified using PCR primers flanking each sgRNA location (listed in Table S2) ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted in biological triplicate per condition (0.03% and 5% CO2) using the E.Z.N.A.™ Yeast RNA Kit (Omega Bio-Tek, R6870-01) as per the manufacturer’s instructions with a few modifications ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR products were fluorescently labeled at the 5′ ends with Cy5 (Yingjun Corp. China) and purified by gel extraction (OMEGA Bio-TEK). Fluorescently-labeled DNA was then detected using a Biophotometer Plus (Eppendorf ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted from 5 mg of spleen lysate using the Omega Biotek Total RNA 96 kit (Omega Bio-Tek, Norcross, GA) and a KingFisher Flex Instrument (ThermoFisher Scientific ...