Labshake search
Citations for Omega Bio-Tek :
1 - 9 of 9 citations for 6H INDOLO 2 3 B QUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... DNA was extracted from the CRISPR-cas9 targeted Calu-3 cells using E.Z.N.A Tissue DNA Kit (Omega Bio-Tek, Norcross, GA), and the ACE2 regulatory element/sub-element region was amplified using PCR primers flanking each sgRNA location (listed in Table S2) ...
-
bioRxiv - Microbiology 2022Quote: RNA was extracted from isolated clinical SARS-CoV-2 with E.Z.N.A total RNA (Omega Bio-Tek). Maxima H Minus cDNA Synthesis (Thermofisher ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was obtained from all BEC lines (3 Ctrl BEC and 5 SZP BEC) by phenol-chloroform extraction using RNAsolv (Omega Bio-Tek, Norcross, GA, USA). 1 μg of RNA was treated with DNase I (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... The amplified product was run on 2% agarose gel and purified by OMEGA Gel purification Kit (OMEGA Bio-Tek). Next ...
-
bioRxiv - Microbiology 2023Quote: ... and 0.25 ml was immediately transferred to 2 ml disruptor tubes (Omega Bio-Tek E.Z.N.A Soil DNA; Norcross GA), then stored at -80ºC until DNA extraction ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the protein was eluted with six column volumes of 0-100% gradient of elution buffer (binding buffer with 500 mM imidazole) and 2 ml fractions were collected into 96 deep well plates (Omega Bio-tek). The collected fractions were run on SDS-PAGE gel and the fractions corresponding to His10-SUMO-RelA with the least nucleic acid contamination was collected (≈5 ml ...
-
bioRxiv - Synthetic Biology 2021Quote: ... all products were run on a 2 w/v% agarose gel to verify successful amplification of target and then purified using a PCR purification kit (Omega Bio-Tek). The prepared linear DNA was either directly used in cell-free and cell-free ATPS reactions or used as a template for in vitro transcription.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Amplified DNA was run on a 2% agarose gel and were excised and purified using the MicroElute Cycle-Pure Kit (Omega Bio-Tek). Purified DNA was Sanger sequenced by Cornell Institute of Biotechnology ...