Labshake search
Citations for Omega Bio-Tek :
1 - 4 of 4 citations for 6 METHOXY THIOCHROMAN 3 YLAMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: Whole genomic DNA was extracted from either the whole specimen or pereopods 6–7 depending on the size of the amphipod using an EZNA Tissue DNA kit (Omega Bio-tek Inc.) following manufacturer’s protocols ...
-
bioRxiv - Genetics 2021Quote: ... DNA was extracted from the CRISPR-cas9 targeted Calu-3 cells using E.Z.N.A Tissue DNA Kit (Omega Bio-Tek, Norcross, GA), and the ACE2 regulatory element/sub-element region was amplified using PCR primers flanking each sgRNA location (listed in Table S2) ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was obtained from all BEC lines (3 Ctrl BEC and 5 SZP BEC) by phenol-chloroform extraction using RNAsolv (Omega Bio-Tek, Norcross, GA, USA). 1 μg of RNA was treated with DNase I (Invitrogen ...