Labshake search
Citations for Thermo Fisher :
4401 - 4450 of 10000+ citations for 1 2 Dihydro 1 2 tetrahydro 2H pyran 2 yl oxy ethyl 5H tetrazole 5 thione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Biochemistry 2022Quote: The purified AAGAB protein was cross-linked with a solution of 1:1 BS3-d0: BS3-d4 (ThermoFisher #21590 and #21595) crosslinkers ...
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
bioRxiv - Immunology 2020Quote: ... After the fourth EDTA incubation the pieces were cut into 2 mm2 pieces and placed in 5 mL digestion solution containing 5% fetal bovine serum (Gibco), 10 mM HEPES (Gibco) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples (5 μl) were injected on a C18 PepMap trap column (5 μm, 100 μm I.D. x 2 cm, Thermo Scientific) at 10 μl/min ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples (5 μl) were injected on a C18 PepMap trap column (5 μm, 100 μm I.D. x 2 cm, Thermo Scientific) at 20 μl/min ...
-
bioRxiv - Developmental Biology 2023Quote: ... and incubated for 2-24hrs at 37°C 5% CO2 +/- myristoylated aPKC pseudosubstrate inhibitor (5 μM; Invitrogen; Product number 77749) in IMDM+0.1% BSA ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples (5 μL) were injected on a C18 PepMap trap column (5 µm, 300 µm I.D. x 2 cm, Thermo Scientific) at 20 µL/min ...
-
bioRxiv - Biochemistry 2024Quote: ... were maintained by continuous culture at 2-5% hematocrit in human erythrocytes with malaria culture medium (RPMI 1640 supplemented with 5 g/L Albumax II (Gibco), 0.12 mM hypoxanthine (1.2 ml 0.1 M hypoxanthine in 1 M NaOH) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The relative expression of each target was calculated using the relative quantification method (2-ΔΔCT) with RNA18S (5’-TGTGGTGTTGAGGAAA-GCAG-3’ and 3’-TCCAGACCATTGGCTAGGAC-5’; Invitrogen) as internal control ...
-
bioRxiv - Immunology 2021Quote: ... 2 ng/μL), CD8a (clone 53-6.7, 2 ng/μL), CD62L (clone MEL-14, 0.8ng/μL) from Thermofisher. For intracellular cytokine staining ...
-
bioRxiv - Genomics 2020Quote: ... SARS-CoV-2 genome was amplified by using Ion AmpliSeq SARS-CoV-2 Research Panel (ThermoFisher Scientific, USA) that consists of two pools with amplicons ranging from 125 bp to 275 bp in length and covering >99% of the SARS-CoV-2 genome ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were resuspended in MACS buffer containing 2 µg/mL 4’,6-diamidino-2-phenylindole (DAPI; Life Technologies). A BD FACSAria III Cell Sorter (BD Biosciences ...
-
bioRxiv - Bioengineering 2022Quote: ... and vascular endothelial growth factor receptor 2 (VEGFR-2, Catalog No. PA5-16487, Thermo Fisher Scientific, Waltham, MA). For sections being stained for a target antigen ...
-
bioRxiv - Developmental Biology 2020Quote: ... samples were incubated with secondary antibodies (Supplemental Table 2) and 2 U/sample phalloidin-AlexaFluor488 (Thermo Fisher Scientific) in blocking solution for 2 h in darkness ...
-
bioRxiv - Cancer Biology 2020Quote: ... M25 IgG1 was partially reduced with 2 equivalents of Tris(2-carboxyethyl) phosphine hydrochloride (TCEP, Thermo Fisher Scientific) at 37 °C for 2h ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μg of N501Y-SARS-CoV-2 BAC were transfected into Vero E6 (ATCC) with Lipofectamine 3000 (Invitrogen) in a 6-well plate according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: 293T cells (2 × 106) were transfected with 2 μg spike expression vector by lipofection using lipofectamine 2000 (Invitrogen). One day post-transfection ...
-
bioRxiv - Immunology 2023Quote: ... was made by mixing 2.5ug of IL-2 monoclonal antibody (JES6-1A12, 2B Scientific) with 7.5ug recombinant IL-2 (ThermoFisher) in 200ul of PBS for 20 minutes at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... and every 2 hrs a 2 mL treatment culture was stained with Sytox blue dead cell stain (Invitrogen) at a concentration of 1 uM per manufacturer’s protocol and incubated at room temperature for 5 min ...
-
bioRxiv - Physiology 2022Quote: ... for 2 h at 120V and transferred to nitrocellulose membranes using the iBlot 2 mini-stacks (IB23002; Invitrogen) according to the manufacture’s guidelines ...
-
bioRxiv - Cell Biology 2024Quote: ... at 2 μg/mL and Alexa Fluor 647 goat anti-mouse F(ab’)2 (Invitrogen, catalog A-21237) at 2 μg/mL were used ...
-
bioRxiv - Immunology 2023Quote: ... cells treated with LP were loaded with 2 μM of the acetoxymethyl ester form of Fura-2 (Invitrogen) in RPMI-1640 at 37°C for 30 min and fluorescence data were analyzed using MetaFluor (Molecular Devices ...
-
bioRxiv - Molecular Biology 2022Quote: ... 484 bp for group 2) was excised using a 2% E-Gel SizeSelect Agarose Gels (Thermo Fisher Scientific). The sequence library was adjusted to 10 pM (assuming 1 bp DNA has a molecular weight of 660 g/mol ...
-
bioRxiv - Immunology 2023Quote: single-cell suspensions of spleen were prepared in FACS buffer (2% FBS, 2 mM EDTA, in PBS (Gibco)) and were treated with ACK buffer (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1.5 or 2 µg rrsp-mRNA by PPDP2 nanocarriers or 2 µg rrsp-mRNA via MessengerMAX lipofectamine (Invitrogen) for 72 h ...
-
bioRxiv - Biophysics 2024Quote: ... and N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid (HEPES) supplemented with 10% fetal bovine serum (FBS) (26140079, Gibco), 1% penicillin/streptomycin (15140122 ...
-
bioRxiv - Bioengineering 2024Quote: ... Cell nuclei were counter stained with 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/ml; Molecular Probes) prior to mounting onto glass slides and then cover slipped with ProLong Gold (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... The crosslinking reaction was quenched with 4X quenching buffer (36 mM Tris, pH 8.0 with 0.4% w/v 2-octylpyranoglucoside (2-OG) (Affymetrix)) for a final Tris and detergent concentration of 9 mM and 0.1% ...
-
bioRxiv - Immunology 2024Quote: ... and then resuspended in FACS buffer (RPMI, supplemented with 2% FBS and 2 mM EDTA [Thermo Fisher Scientific]) prior to counting ...
-
bioRxiv - Neuroscience 2024Quote: ... the medium was replaced with Neurobasal A medium supplemented with 2% B27 and 2 mM GlutaMAX (Life Technologies). Cells were then stored in the incubator for 10 DIV followed by replacement of half of the medium with fresh B27-Neurobasal A medium containing 2μM Aβ or 2μM gAβ or vehicle which were kept for 24 hours.
-
bioRxiv - Systems Biology 2020Quote: ... Disulfide bonds were reduced with 5 mM Tris(2-carboxyethyl)phosphine (TCEP) Bond-breaker (Thermo Scientific) at RT for 1 hr ...
-
bioRxiv - Cell Biology 2020Quote: ... protected by an Acclaim PepMap C18 column (100 μm x 2 cm, 5 μm; Thermo Scientific) before injection into a Q-Exactive mass spectrometer (ThermoFisher) ...
-
bioRxiv - Microbiology 2020Quote: ... The precolumn was a 2 cm EASYcolumn (ID 100 µm, 5 µm particles) (Thermo Fisher Scientific) while the analytical column was a 10 cm EASY-column (ID 75 µm ...
-
bioRxiv - Developmental Biology 2021Quote: ... The eggs were then loaded with the calcium indicator Fura-2 AM (5 μM; Thermo Fisher) for 30 min in KSOM containing 0.02% pluronic F-127 (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... the drinking water contained thymidine analogue EdU (5-ethynyl-2’-deoxyuridine, Thermo Fisher, cat. no: E10415) to label newly-generated cells ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... the Click-iT EdU (5-ethynyl-2’-deoxyuridine) Alexa Fluor (AF) 568 imaging kit (Molecular Probes) was used in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... injection of EdU (5-ethynyl-2’-deoxyuridine; Click-it EdU Alexa Fluor 488 imaging kit, Invitrogen) at 5 and 6 days DPD at 50 mg/kg ...
-
bioRxiv - Immunology 2020Quote: ... washed 2 × 100μL with complete RPMI and stained with 5 nM TMRE (T669, Thermo Fisher Scientific) in 200 μL complete RPMI at RT for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primer extension was performed with 2 pmol of DNA gene-specific primers (5’CATGCTTAACGTAATTCAACAGAAATTATATG) by Invitrogen SuperScript III reverse transcriptase ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR detection of SARS-CoV-2 was performed on a QuantStudio 5 instrument (Applied Biosystems) using a TaqPath 1-step RT-qPCR Master Mix (Applied Biosystems ...
-
bioRxiv - Zoology 2020Quote: ... After 2 h and 30 min we added 5 μM dihydrorhodamine-123 (DHR) (Thermo Fisher Scientific) to the cell suspension to stain cells positive for reactive oxygen species (ROS ...
-
bioRxiv - Genomics 2021Quote: ... followed by 2 x 5 min washes in PBS before mounting in Prolong Diamond (Life Technologies).
-
bioRxiv - Immunology 2020Quote: T cells (5×106) from triplicates of 2 independent experiments were lysed in TRIzol reagent (ThermoFisher). Total RNA was isolated per manufacturer’s instruction and resuspended in RNase free water ...
-
bioRxiv - Immunology 2020Quote: Mice were injected intraperitoneally with 0.5 mg 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen or Sigma-Aldrich). For pulse experiments ...
-
bioRxiv - Developmental Biology 2023Quote: The medusae were incubated with 150 μM 5-ethynyl-2’-deoxyuridine (EdU) (EdU kit; Invitrogen, C10337) in ASW for 1 h or 24 h ...
-
bioRxiv - Cell Biology 2023Quote: ... TMT reaction was allowed for 2 hours and quenched with 5% hydroxylamine (90115, Thermo Fisher Scientific). All the samples were pooled and dried in a SpeedVac (EP022822993 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of sgRNA plasmid was transfected to PLC/PRF/5 cells using Lipofectamine 3000 (Invitrogen). After 2 days’ culture in DMEM medium ...
-
bioRxiv - Bioengineering 2022Quote: ... RBC (5 million cells/mL) were incubated with 2 μg/mL calcein AM (Thermo Fisher Scientific) for 15 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... with the first wash including 5 µg/ml DAPI (4′,6-diamidino-2-phenylindole; ThermoFisher Scientific) to stain nuclei ...