Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 3 Chloro 5 fluoro 4' morpholinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was discarded and the pellet was resuspended in 5 mL liquid KNOP supplemented with 2% (w/v) sucrose (#S/8600/60, Fisher) and 100 μM 3’,5’-dimethoxy-4’-hydroxyacetophenone (acetosyringone) (#115540050, Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (#D8418 ...
-
bioRxiv - Microbiology 2022Quote: ... The F gene was PCR amplified using primers RSV F 5’ (5’GCAAGGATTCCTTCGTGAC3’) and RSV F 3’ (5’CACACCACGCCAGTAG3’) and Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Sanger sequencing was performed by Elim Biosciences.
-
bioRxiv - Developmental Biology 2022Quote: ... and passaged very 3-4 days with a 1:4-6 passage ratio using Versene solution (Life Technologies 15040066).
-
bioRxiv - Physiology 2021Quote: ... and incubated with secondary antibody (conjugated goat anti-rat Alexa fluoro 546, 1:1,000 dilution, A11081; Invitrogen by ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were processed using the Click-iT™ EdU Alexa Fluoro™ 647 imaging Kit (Thermo Fisher) following the manufacturer’s protocol.
-
bioRxiv - Biophysics 2023Quote: ... 100 nm diameter blue beads with an excitation wavelength (λex) of 450 nm (Fluoro-Max; Fisher Scientific), 100 nm diameter yellow bead ...
-
bioRxiv - Biophysics 2023Quote: For point spread function evaluation a sample of 500 nm microbeads (Thermo Scientific Fluoro-Max green G500) was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2024Quote: ... isolated cerebral microvessels (5 animals per group) or hippocampus (3-5 animals per group) using Trizol (ThermoFisher, MA) and the Qiagen RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... TcBDF2W92AFw (5’CGACTCCGCTGCGGTTAAAG-3’) and TcBDF2W92ARv (5’-CTTTAACCGCAGCGGAGTCG-3’).The PCR products were first cloned into the pCR2.1-TOPO vector (Invitrogen) and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: To generate construct drg1 [prab-3∷GCaMP6m∷NLS∷unc-54 3’UTR] we performed a 4-way Gateway recombination reaction using LR Clonase II (Invitrogen). We recombined pDEST II with the following entry clones ...
-
bioRxiv - Biochemistry 2022Quote: ... The quality of obtained microsomes was tested with 9-amino-6-chloro-2-methoxyacridine (ACMA; Invitrogen A1324) fluorescence quenching assays.
-
bioRxiv - Immunology 2020Quote: ... 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB (Thermo Fisher Scientific; (Bruner et al., 2016)) ...
-
bioRxiv - Immunology 2020Quote: ... 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB (Thermo Fisher Scientific; (Schmid et al., 2010)).
-
bioRxiv - Microbiology 2021Quote: ... Sections were cut at 3-5 μm on a cryotome (ThermoFisher Scientific) using C35 carbon steel blades (Feather ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 5 μl Turbo DNase buffer and 3 μl Turbo DNase (ThermoFisher Scientific) were added to each reaction and incubated for 30 min at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific) were applied for monitoring effector caspase activation and 2.5 µM AlexaFluor647 hydrazide for detecting cell lysis.
-
bioRxiv - Cancer Biology 2022Quote: ... Cell pellet was suspended in 3-5 ml TrypLE Express (ThermoFisher, 12605028) depending on the pellet volume and incubated at 37°C for 10-15 min with mixing every 5 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 10% (for RS-5) or 20% (for DM-3) FBS (Gibco). All the other cells were cultured in RPMI medium (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were passaged every 3-5 days using Trypsin-EDTA (Gibco, 25200056). All experiments were done with cells at 10 passages or earlier with regular testing for mycoplasma ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-ATTTGTCGACTCATTCTAATCCTTCGTCTTTTGATT-3′ by using Phusion high-fidelity DNA polymerase (Thermo Scientific) and cDNA prepared from the parasites as template ...
-
bioRxiv - Cell Biology 2020Quote: ... were transfected with human myosin VI siRNA duplex (5′GGUUUAGGUGUUAAUGAAGtt-3′) (Ambion) or AllStars Negative Control siRNA duplex (Qiagen ...
-
bioRxiv - Biophysics 2021Quote: ... LUVs were prepared using sonication (Fisher Scientific, Ultrasonic Bath, 3 × 5 min). Sonication was performed in ice water bath ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl Turbo DNase buffer and 3 μl Turbo DNase (ThermoFisher Scientific) were added to each sample and incubated for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... TOGARAM1 was depleted using siRNA with sequence 5′-CCUCGUAAUUCCUUAGAAA-3′ (Thermo Scientific) Cells were seeded onto coverslips at 70% confluency and transfected with 50 nM of siRNA in two sequential transfections using Lipofectamine RNAiMAX (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... ID: s2513 (Silencer Select Validated; 5’-GA UAUACCCUGGAAAGUCUtt-3’) (Thermo Fisher Scientific) with JetPrime (Polyplus ...
-
bioRxiv - Molecular Biology 2024Quote: ... and cel-miR-54-3p (C. elegans sequence: 3’-UACCCGUAAUCUUCAUAAUCCGAG-5’, Invitrogen) were added to each sample and used as external controls.
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Cancer Biology 2021Quote: ... Excess cells were washed off with PBS (4×5 mL, Gibco), briefly left in RPMI (5 mL ...
-
bioRxiv - Neuroscience 2021Quote: ... The cells were loaded with 5 μM fluo-4 AM (Invitrogen) in Hanks’ balanced salt solution (HBSS ...
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-5 μl Page Ruler Pre-stained Protein Ladder (Thermo Scientific), and 10 μl of 4X Dye (last three grooves ...
-
bioRxiv - Cancer Biology 2024Quote: ... Excess cells were washed off with PBS (4×5 mL, Gibco), briefly left in RPMI (5 mL ...
-
bioRxiv - Microbiology 2024Quote: ... 4 µl of T4 DNA ligase (Thermo Fisher, 5 WU/µl) was added ...
-
bioRxiv - Microbiology 2021Quote: ... Streptomyces hyphae were incubated with 0.5 mg/ml FM 4-64 Dye (N-(3-Triethylammoniumpropyl)24-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Molecular Probes) for 15 min in the dark ...
-
bioRxiv - Microbiology 2024Quote: ... at physiological pH before being spun down and resuspended in PBS with the addition of FM 1-43 Dye (N-(3-Triethylammoniumpropyl)-4-(4-(Dibutylamino) Styryl) Pyridinium Dibromide (Cat. no. T3163, Invitrogen). Images were taken on a Zeiss X10 light microscope and cell area was measured using CellProfiler 4.2.1 (33,34).
-
bioRxiv - Molecular Biology 2023Quote: ... stained with N-(3-triethylammonium propyl)-4-(4-(dibutyl amino) styryl) pyridinium dibromide (FM 1-43FX, Invitrogen, Cat.-No. F35355) at 5.6 µg ml-1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... These lines were routinely passaged every 3-4 days using Versene (ThermoFisher; 15040066). All lines were routinely screened for differentiation and tested for mycoplasma contamination.
-
bioRxiv - Biophysics 2022Quote: ... DiD (1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine, 4-Chlorobenzenesulfonate salt) was purchased from ThermoFisher scientific (Molecular probes ...
-
bioRxiv - Neuroscience 2020Quote: ... Secondary antibody incubation was performed for 3-4 days and DiD (Thermo Fisher Scientific-Molecular Probes L7781 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3-4 brains were dissected in chilled Schneider’s Drosophila medium (ThermoFisher Scientific, 21720001) in less than 5 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... that accumulates in hyperpolarized membranes and DiBAC(4)3 (Thermo Fisher Scientific, USA) that enters depolarized cells (Suchodolski and Krasowska ...
-
bioRxiv - Cell Biology 2021Quote: ... Bolt 4-12% Bis-Tris or NuPAGE 3-8% Tris-Acetate gels (Invitrogen) were used for electrophoresis ...
-
bioRxiv - Developmental Biology 2021Quote: ... and passaged every 3 – 4 days using Versene (Cat. # 15040066, Thermo Fisher Scientific). Culture dishes were pre-coated with 0.5% GelTrex matrix solution (Cat ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were split every 3-4 days when confluent using TrypLE Express (Gibco). For all immunoblotting and imaging experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... and resolved on 3-8% or 4-12% gradient SDS-PAGE gels (ThermoFisher) transferred to nitrocellulose membrane ...
-
bioRxiv - Neuroscience 2023Quote: ... 3/4 of the medium was replaced with Neurobasal medium (GIBCO, 21103-049) containing B27 and glutamax ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-4 days using TrypLE Express (ThermoFisher, Cat# 12605036) and confirmed to be free of mycoplasma ...
-
bioRxiv - Neuroscience 2023Quote: ... After 3–4 days the colonies were dissociated using StemPro Accutase (Thermo Fisher), counted and plated at low confluency (10,000 cells/cm² ...
-
bioRxiv - Immunology 2024Quote: ... Cells were passaged every 3-4 days using 0.05% Trypsin-EDTA solution (Gibco).