Labshake search
Citations for Thermo Fisher :
151 - 200 of 7259 citations for 6 6' Di O tert butyldimethylsilyl D lactal since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and 6 mM magnesium chloride (Invitrogen) was assembled ...
-
bioRxiv - Microbiology 2024Quote: ... a 6% DNA retardation gel (Thermofisher) was pre-run at 90 V for 5 minutes with 0.5X TBE buffer (prepared from 5X TBE buffer (Thermofisher)) ...
-
bioRxiv - Immunology 2024Quote: ... in 6-well plates (Thermo Scientific) at 1.5x106 cells per well for 1 h at 37°C in warm RPMI-1640 medium (GIBCO) ...
-
bioRxiv - Cell Biology 2024Quote: ... 6) glucose-free DMEM (Gibco, 11966025) for 24 hr ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 6 mM magnesium chloride (Invitrogen) was added ...
-
bioRxiv - Neuroscience 2024Quote: ... and QuantStudio 6 Flex system (ThermoFisher). The cDNA amplification cycle number was determined by ∼25% of the peak fluorescence value ...
-
bioRxiv - Cell Biology 2020Quote: ... 1.8 mM CaCl2, 6 mM NaHCO3, 5.5 mM D-glucose, 25 mM HEPES, pH 7.4 supplemented with Gibco MEM Amino Acids and MEM Non-Essential Amino Acids solution ...
-
bioRxiv - Neuroscience 2021Quote: ... while levels of IL-6 in supernatants were determined using IL-6 mouse ELISA kit (Thermo Scientific). Similarly ...
-
bioRxiv - Immunology 2021Quote: ... 5/6 weeks and 6/7 weeks post-infection by flow cytometry using counting beads (CountBright, ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... transferred to 6 ml liquid MSgg medium of each well of a 6-well microplate (Thermo Scientific), and then grown for additional four days ...
-
bioRxiv - Microbiology 2020Quote: ... 6 × 105 293LTV cells were seeded in a 6-well plate and transfected using Lipofectamine 2000 (Invitrogen) which was complexed with DNA plasmids driving the expression of either VSV G protein (positive control) ...
-
Incidence of an intracellular multiplication niche amongst Acinetobacter baumannii clinical isolatesbioRxiv - Microbiology 2021Quote: ... The concentration of IL-6 was quantified by ELISA (Human IL-6 ELISA Ready-SET-Go!, Thermofisher) by following the supplier’s protocol.
-
bioRxiv - Biophysics 2023Quote: 6-well plate cell proliferation – Cells were seeded into 6-well plates (Fisher Scientific, 07-200-83) 150,000 cells/well and left at ambient temperature for 20 minutes to ensure homogeneous settling ...
-
bioRxiv - Cell Biology 2023Quote: ... Coding regions were transferred into Pvha-6-GFP or Pvha-6-RFP vectors by LR reaction (Invitrogen). Constructs were bombarded into unc-119(ed3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... ANBL-6 cells were also supplemented with 5 ng/ml IL-6 (Thermo Fisher Scientific, Cat# 206IL010).
-
bioRxiv - Genomics 2023Quote: ... for 2 h and with 33 nM C12FDG (5-Dodecanoylaminofluorescein Di-β-D-Galactopyranoside; ThermoFisher D2893) for 1 h ...
-
bioRxiv - Bioengineering 2023Quote: ... and tert-butyl hydrogen peroxide (ThermoFisher) were used as standards for the extra- and intracellular assays ...
-
bioRxiv - Microbiology 2023Quote: ... tert-Butyl hydroperoxide (tBOOH – Acros Organics) and diamide (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... Tert-Butyl hydroperoxide (TBT) (Acros Organics) was used as a positive control to induce oxidative stress.
-
bioRxiv - Microbiology 2022Quote: ... or in 2 ml liquid MSgg with 7-d-old tomato seedlings in a 6-well plate (Thermo Scientific). Each well contained one seedling ...
-
bioRxiv - Immunology 2020Quote: ... whereby the transfected population is selected for removal of HXGPRT and replacement with the complementation allele in 6-thioxanthine selection medium [177 µg/mL of 6-thioxanthine (TRC, cat# T385800) in 4.5 g/liter D-glucose in GlutaMAX DMEM (Gibco), with 1% dialyzed FBS (Omega Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... TNF-α and IL-6 in cell culture supernatants were assayed using standard ELISA kits (Invitrogen or R&D) in accordance with the protocol set out by the manufacturer ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixture was resuspended in 1 ml of DMEM before adding the mixture to a 6-well plate containing 2 ml of DMEM with 4.5 g/L D-Glucose and L-Glutamine (Gibco) supplemented with supplemented 10% FBS ...
-
bioRxiv - Plant Biology 2024Quote: ... 8 and 6 hours were then transferred to MS medium containing zeocin with Actinomycin D (Thermo Fisher, J60148.LB0) or zeocin with DMSO (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... thaliana seedlings cultured in 6 ml liquid MSgg of each well of a 6-well microplate (Thermo Scientific). 8 seedlings were put in each well ...
-
bioRxiv - Microbiology 2020Quote: ... Cells in antibiotic free media (8×105/6-well) were transfected 6 hours post infection with 2μg plasmid and 6μl Lipofectamine 2000 (Invitrogen) per well diluted in Opti-MEM (Invitrogen).
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Jurkat cells and NALM-6 expressing firefly luciferase- GFP (NALM-6) were cultured in RPMI 1640 (Thermo Fisher) supplemented with 10% FBS and 100 units/mL penicillin and streptomycin ...
-
bioRxiv - Genomics 2024Quote: ... C57BL /6 wildtype keratinocytes were seeded in a 6-well plate (Thermo Scientific Nunclon TM Delta Surface; 140675) at 1.5-3 × 105 cells per well ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific). Cells were imaged using a Zeiss Axio fluorescence microscope.
-
bioRxiv - Neuroscience 2021Quote: ... with Essential 6 medium (#A1516401; Life Technologies) containing dorsomorphin (2.5 μM ...
-
bioRxiv - Molecular Biology 2020Quote: ... Twelve-well Novex 6% Trisglycine gels (Invitrogen) were pre-run in 0.5× Tris-Borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen) for 3 min and washed ...
-
bioRxiv - Genomics 2020Quote: ... on the QuantStudio 6 Flex (Life Technologies). Next ...
-
bioRxiv - Immunology 2021Quote: ... IL-6 mouse ELISA kit (ThermoFisher Scientific) and IL-1β mouse ELISA kit (ThermoFisher Scientific) ...
-
bioRxiv - Genetics 2020Quote: ... or the QuantStudio 6 Flex (Thermo Fisher). Samples were analyzed using a two-step amplification and melt curves were obtained after 40 cycles ...
-
bioRxiv - Genetics 2020Quote: ... or the QuantStudio 6 Flex (Thermo Fisher). The Ct values were analyzed by the enrichment compared to input method.
-
bioRxiv - Bioengineering 2021Quote: ... 6-Diamino-2-Phenylindole (DAPI, ThermoFisher, USA). The staining solution was then washed with PBS.
-
bioRxiv - Bioengineering 2020Quote: ... DAPI ((4’,6-diamidino-2 phenylindole, Invitrogen) was added and samples were covered with coverslips ...
-
bioRxiv - Neuroscience 2020Quote: ... with 6 μl of RNaseout (Life Technologies). The lysates were sequentially treated with 12.6 μl of RNase-free DNase (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... QuantStudio 6/7 Pro systems (Applied Biosystems). The following primers were used ...
-
bioRxiv - Microbiology 2021Quote: ... in a QuantStudio 6 thermocycler (Applied Biosystems) or in a StepOne Plus thermocycler (Applied Biosystems) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 6 ug/mL Puromycin (Gibco #A1113803).
-
bioRxiv - Cell Biology 2021Quote: ... 12 (Fisher Scientific DF2948-47-6; RRID:AB_2884995); Mouse mAb anti-Cdc42 (BD Biosciences 610928 ...
-
bioRxiv - Cell Biology 2021Quote: ... MAN0017058 by Invitrogen (pages 5 and 6). A non-targeting sgRNA that does not recognize any sequence in the human genome was used as a negative control (Invitrogen Cat# ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 6% TBE gel (ThermoFisher Scientific, EC62655BOX), and imaged with 4200 TapeStation (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylinodole (DAPI; Molecular Probes). Images were acquired on a DeltaVision Elite microscope using a 60X ...