Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for 3 Chloro 5 fluoro 4' morpholinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 5-7 × 106 cells were resuspended in 3 mL of FACS buffer (4% FBS in phosphate buffered saline (PBS, Gibco)) and sorted at the University of Massachusetts Amherst Flow Cytometry Core Facility using a BD FACSAria Fusion (Becton Dickinson) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 x 5 min) on a rocking platform and stained with 4′,6-diamidino-2- phenylindole dihydrochloride (DAPI) (Life Technologies) staining (2 μM ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% CO2 in a humidified incubator and were passaged every 3-4 days using 0.05% Trypsin-EDTA (ThermoFisher Scientific, 25300). Stable U2OS-derived cell lines ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Cell Biology 2024Quote: ... or BODIPY 558/568 C12 (C12) (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (ThermoFisher, #D3835) were complexed with fatty acid-free bovine serum albumin (BSA ...
-
bioRxiv - Immunology 2020Quote: ... before staining with 3 μM fluo-4 (Invitrogen) and 4 μM Fura Red (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 × 10−3 M GlutaMAX supplement (35050061, Gibco), 2 × 10−4 M L-cystine (C7602 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Biophysics 2020Quote: ... green nanospheres (200 nm, 1% solids, Fluoro-Max, Thermo Scientific, CA, US) were premixed in the gelatin (1:20 ...
-
bioRxiv - Neuroscience 2022Quote: ... and Alexa Fluoro-488 goat anti-rabbit IgG (H+L) (Invitrogen, A11034) in wash solution for 2 hours at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... donkey Alexa Fluoro 647-conjugated anti-goat IgG (#A11001; Thermo Fisher Scientific), and goat Alexa Fluoro488-conjugated anti-rabbit IgG (#A11001 ...
-
bioRxiv - Bioengineering 2024Quote: ... Fluoro-Max dyed blue aqueous fluorescent particles (2µm diameter, B0200, Thermo Scientific), Recombinant Alexa Fluor® 647 Anti-VEGFA antibody [EP1176Y] (ab206887 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 7-Diethylamino-3-(4'-Maleimidylphenyl)-4-Methylcoumarin (CPM) was purchased from Thermo Scientific Life Technologies (Grand Island ...
-
bioRxiv - Biochemistry 2024Quote: ... as was 7- Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen™ D346) and CPM stock was prepared at 5 mg/mL ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Microbiology 2023Quote: ... 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated into a PCR by the use of a DreamTaqTM DNA Polymerase (Thermo Scientific™ ...
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Plant Biology 2022Quote: ... N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM 4-64; 50 μM) (Invitrogen) or propidium iodide (PI ...
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies; non-targeting control ...
-
bioRxiv - Biochemistry 2021Quote: EB1 was amplified from pET24d-His-TEV-EB1 plasmid using the primers 5’-CACCATGGCTGTAAACGTCTACTC-3’ and 5’-TTACTTGTAGAGCTCGTCCATGC-3’ and inserted into pENTR/D-TOPO (Invitrogen). Using Gateway LR Clonase II (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... was prepared by PCR from plasmid SB649 (20) using primers 5′-biotin-GTTGGGTAACGCCAGGG-3′ and 5′-Alexa488-GGAAACAGCTATGACATG-3′ (IDT) and Platinum Taq DNA Polymerase (Invitrogen). The PCR product was purified using DNA SizeSelector-I SPRI magnetic beads (Aline Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... the mCherry-FLAG-HA-MKAKU41 gene construct was amplified using KAKUattF (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTTAGCAAGGGAGAAGAGG-3’) and KAKUattR (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACGTAGCCCGTCCCCGT-3’) primers and inserted into pDONR221 vector by BP cloning (Invitrogen), to generate the MKAKU41 entry clone ...
-
bioRxiv - Cell Biology 2021Quote: ... The precore precursor gene was amplified using the forward primer 5’-ATCTAAAGCTTACCATGCAACTTTTTCACCTCT-3’ and reverse primer 5’-TAGATGGATCCCTAACATTGAGGTTCCCGAG-3’ and introduced into the pCEP vector (Invitrogen) via HindIII and BamHI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... bovis DSM 6328 genomic DNA with the primer pair mbxA-for 5‘-AACCTTTTCTAACACAACGAGGAGAGAC-3‘ and mbxA-rev 5‘- AAATCACTAAACACTTGGAGCCAAAATTC-3‘ and cloned into the pJET1.2 vector (Thermo Scientific). Subsequently the mbxA gene was cloned into the pSU2726 hlyA vector (60 ...
-
bioRxiv - Biochemistry 2022Quote: ... target cleavage was monitored using synthetic RNA oligonucleotides radiolabeled by ligating [5′-32P] cytidine 3′,5′-bisphosphate to the 3′ end of the target with T4 RNA ligase I (Ambion). The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... amplified with primers attB1 5’-TTACTCCATGTGTCAATACCAAAA-3’ and attB2 5’-GTCCATTTTAGTTCTCGAGTCGG-3 and introduced into the pDONR207 Gateway donor vector (Invitrogen). The NTF-GFP fragment was amplified by PCR from the published construct (Deal and Henikoff ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 150 nM v3’ template RNA (FluPolA: 5’-AGUUUGCCUGCUUCUGCU-3’, FluPolB: 5’-UAUACCUCUGCUUCUGCU-3’) and 250 µM NTP mix (ThermoFisher). 50 µM CTD peptides were added at concentrations corresponding to at least a 10-fold excess over the KD of the lowest measured affinity for a two-repeat peptide ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Molecular Biology 2022Quote: ... HDAC BamHI_FP: 5’-CGCGGATCCATGTCTAATAGAAAAAAGGTTGC-3’,and HDAC_XhoI_RP: 5’-CCGCTCGAGTTAATATGGTACAATAGATTGATCC-3 with Phusion™ High-Fidelity DNA Polymerase (Thermo Scientific, US). The amplified DNA fragment was purified with QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: Full length mouse Unkempt was amplified from cDNA using primers 5’-CACCAGATATCCAATGTCGAAGGGCCCCGGGCCCG-3’ and 5’-GACGACTCTAGATCACGACTGGAGGGCATGGGCCC-3’ and cloned into pENTR/D-TOPO (ThermoFisher) according to the manufacturer’s instructions to create pENTR-Unk ...
-
bioRxiv - Genetics 2022Quote: ... of a PCR amplified region of the rgr-1 locus using OneTaq 2x Master Mix (forward primer DLO1140 5’-TGGAATGGGACTTCCTCTTG-3’ reverse primer DLO1141 5’-TTTCCAAAAGCCAGGACATC-3’) isolated using a GeneJET PCR Purification kit (ThermoFisher). The rgr-1(gk429013 ...
-
bioRxiv - Immunology 2022Quote: ... burgdorferi strain B31-5A4 using the primers ((BBRecAfp (5’-GTGGATCTATTGTATTAGATGAGGCTCTCG-3’) and BBRecArp (5’-GCCAAAGTTCTGCAACATTAACACCTAAAG-3’)) with qPCR using an Applied Biosystems 7500 Real-Time PCR system (ThermoFisher) in conjunction with PowerUp™ SYBR® Green Master Mix (ThermoFisher ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-caccatggttgtttcaatggctttgg-3’ and 5’-atttgagagagggtcgaaggag-3’ and cloned into pENTR/D-TOPO (Invitrogen). The final construct ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-cacccactttctcttttgttagattctagttg-3’ and 5’-cattctataaat-tgattctcctcttctcc-3’ and cloned into pENTR/D-TOPO (Invitrogen). The construct was cloned into pGWB533 (Nakagawa et al. ...
-
bioRxiv - Genetics 2020Quote: ... EAC11-F: 5′-TTGAATTCGACTTCGACCGCGGCGTTTT-3′ and EAC12-R: 5′-TTGAATTCATGTCTTGGCCAGGGGAGAG-3 and cloned into the entry vector pCR8/GW/TOPO (Invitrogen). In the next step ...
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
bioRxiv - Immunology 2021Quote: ... Rps29 (forward 5’-GCAAATACGGGCTGAACATG-3’; reverse 5’-GTCCAACTTAATGAAGCCTATGTC-3’) by real-time PCR using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... gins2 cDNA was cloned using primers gins2-F – 5’-CTCCTTGACGTCAGAGACACAT-3’ and gins2-R – 5’-GGAGAGGAATGGCTGAAGTACC-3’ into pCR-Blunt II-TOPO vector (Invitrogen) following the manufacturer’s protocol ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Genotyping proceeded according to the ICS protocol (Forward primer Ef 4877 5’-GACCCACATAAGCAGGGAAGGAGATG-3’, reverse primer L3r 4879 5’-CAATCTCCTGAGAATGTAGCCCACCAT-3’, Invitrogen). The Mrpl54 knock-out allele generated a 402 base-pair (bp ...
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...