Labshake search
Citations for Thermo Fisher :
1201 - 1250 of 10000+ citations for 3 5 Diacetoxy 2 acetoxymethyl 6 phenethyl tetrahydro pyran 4 yl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... sections were counterstained with 1 µg/ml of 4’,6-diamidino-2-phenylindole (DAPI, #D1306, Thermo Fisher Scientific, Waltham, MA, USA) then ...
-
bioRxiv - Molecular Biology 2024Quote: ... coverslips were mounted on glass slides using ProLong Gold antifade (4′,6-diamidino-2-phenylindole) DAPI to counterstain the nuclei (Thermofisher, #P36935).
-
bioRxiv - Cell Biology 2024Quote: ... washed with PBS and stained with a combination of Alexa Fluor secondary antibodies (Thermo) and 4’,6-Diamidino-2-Phenylindole (DAPI; Molecular Probes) for 30 min at RT ...
-
bioRxiv - Molecular Biology 2024Quote: ... the media was removed and cells were stained with 4’,6-diamidino-2-phenylindole (DAPI) at a concentration of 1 µg/mL (ThermoFisher Scientific) in Phosphate-Buffered Saline (PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... RIPA Lysis and Extraction Buffer (CAT NO. 89901), and DAPI (4’,6-Diamidino-2-Phenylindole, Dilactate) (CAT NO. D3571) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... unpermeabilised cells were blocked with 2% FBS/PBS for one hour with immunostaining performed as above with the inclusion of 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher) [1:1000].
-
bioRxiv - Bioengineering 2024Quote: ... Nuclei and F-actin were stained by incubation with 4′,6-diamidino-2-phenylindole (DAPI, 1 μg/mL, Thermo Fisher Scientific) and phalloidin–tetramethylrhodamine B isothiocyanate (phalloidin-TRITC ...
-
bioRxiv - Cell Biology 2024Quote: ... The PA gel surface was functionalized with 1 mg/ml of Sulfo-SANPAH (sulfosuccinimidyl-6-(4-azido-2-nitrophenylamino) hexanoate) in warm 50 mM HEPES buffer (Life Technologies) for immobilization of 100 μg/ml collagen type I (PureCol ...
-
bioRxiv - Cell Biology 2024Quote: ... the slides were washed in 1 x PBS and covered with 4’,6-diamidino-2-phenylindole (DAPI) containing the antifade reagent ProlongGold (Life Technologies). Images for Protein A fusion proteins were obtained using camera Olympus DP73 (Axioplan 2 imaging) ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP7 siRNA: 5’-GCAACACUUAGAAGGAGAAGGCCUA-3’ (1362318, Invitrogen); GTPBP8 siRNA#1 ...
-
bioRxiv - Cell Biology 2023Quote: DCAF5 5‘-GCAGAAACCUCUACAAGAAdTdT-3’ (Ambion, silencer select)
-
bioRxiv - Cell Biology 2024Quote: ... Rab11b - 5’-CUAACGUAGAGGAAGCAUUtt-3’ (Ambion, USA #4390824); Rab35 - 5’-GCAGUUUACUGUUGCGUUUtt-3’ (Ambion ...
-
bioRxiv - Cell Biology 2024Quote: ... Rab11a - 5’-CAACAAUGUGGUUCCUAUUtt-3’ (Ambion, USA #4390824); Rab11b - 5’-CUAACGUAGAGGAAGCAUUtt-3’ (Ambion ...
-
bioRxiv - Cell Biology 2024Quote: ... Rab35 - 5’-GCAGUUUACUGUUGCGUUUtt-3’ (Ambion, USA #4390824). The transfection of single siRNA or a combination of different siRNAs and the rescue of siRNA-treated cells with co-transfection of plasmid DNA and siRNA were completed according to the manufacturer’s (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... reagent at a 4:2:3 ratio of sgRNA/overexpression-construct: pVSVG: psPAX2 in Opti-MEM media (Life Technologies, Thermo Fisher Scientific Inc ...
-
bioRxiv - Neuroscience 2022Quote: ... were loaded at 3 μl/min for 6 min onto a 2 cm × 75 μm C18 trap column (Acclaim Pepmap 100, 3 μm, 300 Å, Thermo Scientific) in loading buffer (0.5% v/v formic acid ...
-
bioRxiv - Molecular Biology 2023Quote: ... Biotinylation of Htz1(V126C) was carried out using N-[6-(Biotinamido)hexyl]-3’-(2’-pyridyldithio)propionamide (HPDP-Biotin) (Thermo Fisher cat. # 21341), which has a pyridyl disulfide moiety ...
-
bioRxiv - Molecular Biology 2024Quote: ... mCherry-LacI-FokI-WT and mCherry-LacI-FokI-D450A expressing vectors 24 were transfected in U2OS 2-6-3 cells using Lipofectamine LTX (Invitrogen; #15338-100) for 24 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... #3: 5′-GAAUAUUGAACUGGAAGCAGCACAU-3′) were purchased as Stealth RNAi siRNAs from Invitrogen. The target sequences were designed using the Block-iT RNAi Designer tool (Invitrogen ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Biophysics 2022Quote: ... BODIPY FL NHS Ester (Succinimidyl Ester) (NHS-BODIPY; catalog number: D2184) were purchased from Invitrogen.
-
bioRxiv - Biochemistry 2024Quote: ... Alexa Fluor 568 NHS Ester and DyLight 633 NHS Ester were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... The assay is based on the dilution of co-mixed N-(7-nitro-benz-2-oxa-1,3-diazol-4-yl)phosphatidylethanolamine (N-NBD-PE) and N-(lissamine Rhodamine B sulfonyl)phosphatidylethanolamine (N-Rh-PE) (Molecular Probes, Eugene, OR, USA), whereby dilution due to membrane mixing results in increased N-NBD-PE fluorescence ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Physiology 2022Quote: ... then perfused the lungs with 3 mL of ice-cold DPBS containing Ca2+ and Mg2+ followed by 5 mL of 4% methanol-free formaldehyde (ThermoFisher) in DPBS containing Ca2+ and Mg2+ ...
-
bioRxiv - Immunology 2022Quote: ... 5-7 × 106 cells were resuspended in 3 mL of FACS buffer (4% FBS in phosphate buffered saline (PBS, Gibco)) and sorted at the University of Massachusetts Amherst Flow Cytometry Core Facility using a BD FACSAria Fusion (Becton Dickinson) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Microbiology 2023Quote: ... was used for induction of gene expression and X-gal (X-Gal 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside; Thermofisher) TSA plates were used for bacterial assessment ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% CO2 in a humidified incubator and were passaged every 3-4 days using 0.05% Trypsin-EDTA (ThermoFisher Scientific, 25300). Stable U2OS-derived cell lines ...
-
bioRxiv - Immunology 2020Quote: ... 2-mercaptoethanol (5 µM, Gibco) and 150 IU/ml human rIL-2 and 50ng/ml rIL-15) ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Immunology 2020Quote: ... before staining with 3 μM fluo-4 (Invitrogen) and 4 μM Fura Red (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 × 10−3 M GlutaMAX supplement (35050061, Gibco), 2 × 10−4 M L-cystine (C7602 ...
-
bioRxiv - Cell Biology 2022Quote: ... A 1 ml aliquot was treated with 2 μM tetramethylrhodamine methyl ester perchlorate (TMRE) (Molecular Probes, USA) and incubated at 37°C for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... burkhardae cells were stained 2 min at RT with 40 μg/mL AF488 NHS ester (ThermoFisher, Germany). Prior to mounting and STED microscopy ...
-
bioRxiv - Microbiology 2021Quote: ... or 10 μM 7-hydroxy-9H-(1,3-dichloro-9,9-dimethylacridin-2-one) succinimidyl ester (DDAO-SE) (Invitrogen) in HMI11 and incubated for 20 min at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Mitochondria labeling was achieved by adding 2 µL of a tetramethyl rhodamine methyl ester (TMRM, ThermoFisher, T668) directly to the medium to achieve a final concentration of TMRM of 100 nM ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were incubated with 20 μM H2DCFDA (5,6-chloromethyl-2’,7’-dichlorodihydro fluorescein diacetate, acetyl ester, Invitrogen) for 6 min at 37 ⁰C as described [44] ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Cell Biology 2024Quote: HEK-293T cells (5×105) were seeded in 2 wells of a 6-well plate in DMEM (Thermo Fisher Scientific #12430054) supplemented with 10% fetal bovine serum (GeminiBio #100-106) ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10−5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10-5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Neuroscience 2020Quote: NO production was detected by DAF-FM diacetate (4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate) (D23844, ThermoFisher). Fly larvae were dissected at 24 or 48 h AI in PBS to expose the sensory neurons ...