Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 5 tert Butyl 3 isocyanatoisoxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Excess secondary antibodies were washed off with PBS (3 washes, 5 minutes each) followed by addition of 32.4 μM of Hoechst nuclear staining reagent (ThermoFisher #H3570) to label nuclei ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human lung fibroblast MRC5 and its SV40-transformed derivatives were cultured in a 5% CO2 and 3% O2-regulated incubator in MEM medium without Phenol Red (Gibco), completed with 10% FBS ...
-
bioRxiv - Plant Biology 2024Quote: Ribosome footprints were prepared from the youngest fully expanded leaf from 5 week old tobacco plants or from 3-week old Arabidopsis seedlings using Ambion RNase I (Invitrogen) as described previously (Chotewutmontri et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were washed 3 times with 1X PBS for 5 minutes each and incubated with secondary antibodies Alexa Fluor 633 (A21094, Thermofisher), Alexa Fluor 555 (A21422 ...
-
bioRxiv - Neuroscience 2024Quote: Duplex of the MEF2C enhancer sequence containing a mutation site [5′-ATGTATTTTTCTGCAATAAGT-3′ (×2)] in human genomic DNA were synthesized (Invitrogen). Additionally ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was extracted from 80–100 pairs of ovaries from 3- to 5-day-old flies (for the analysis of piRNA production in somatic follicle cells) using TRIzol Reagent (Ambion). After 2S rRNA depletion ...
-
bioRxiv - Molecular Biology 2024Quote: ... The siRNA sequences targeting human TFEB (5□-GAA AGG AGA CGA AGG UUC AAC AUC A-3□) were purchased from Invitrogen. The siRNA sequences targeting human NPC1 (5□- CAA UUG UGA UAG CAA UAU UTT-3□ ...
-
bioRxiv - Bioengineering 2024Quote: ... KTB21 human mammary basal epithelial cell line was cultured in epithelial cell growth medium (DMEM [low glucose]: Ham’s F12 [1:3] medium supplemented with 5% FBS [Thermo Fisher Scientific] ...
-
bioRxiv - Genomics 2024Quote: ... Media was changed daily and 3×10^5 cells were passaged every other day using TryplE (Life technologies, Cat.N: 12604013) with a 30-minute selective sedimentation step where the detached cells were kept in an uncoated 10cm dish at 37C to separate ES from MEFs ...
-
bioRxiv - Biochemistry 2024Quote: ... the cells were washed 3 times with imaging buffer and incubated in imaging buffer containing 5 μM EGTA-AM (#E1219, Invitrogen). After 45 min of incubation ...
-
bioRxiv - Biochemistry 2024Quote: siRNA oligonucleotides targeting DEK (5’-GAAGGCTAAGCGAACCAA A-3’) at a final concentration of 50 nM were transfected into cells using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: Antibodies were obtained in >50 ug quantities and labeled with bifunctional 5’ Acrydite - bit sequence - 3’ DBCO oligos (IDT) by enzymatic modification and click chemistry (SiteClick Antibody Azido Modification Kit, ThermoFisher) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... LNCaP cells were seeded at 80% confluence and grown for 3 days in phenol red-free RPMI Medium with 5% charcoal-stripped Fetal Bovine Serum (FBS; #cat 12676029, Gibco) and then stimulated with 10 nM 5-α-dihydrotestosterone (DHT ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary cells were cultured in basal medium ((DMEM [low glucose]: Ham’s F12 [1:3] medium supplemented with 5% FBS [Thermo Fisher Scientific] ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µl sample was applied to glow-discharged grids and incubated for 5 s followed by blotting for 3 sec using a Vitrobot Mark IV (FEI ThermoFisher) operated at 4 °C and 100% humidity ...
-
bioRxiv - Cancer Biology 2024Quote: ... The tissue was washed 3 x 5 min with PBS and thereafter mounted with Prolong Diamond Antiface Mountant (ThermoFisher, P36961). The tissue samples were placed in the dark at RT for at least 1 day before imaging.
-
bioRxiv - Cell Biology 2024Quote: ... Coverslips were washed 3 times for 5 min with 1x PBS before mounting onto glass slides using ProLong Diamond Antifade mountant (Invitrogen) and left to dry overnight at 4°C before imaging.
-
bioRxiv - Cell Biology 2024Quote: ... or BODIPY 558/568 C12 (C12) (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (ThermoFisher, #D3835) were complexed with fatty acid-free bovine serum albumin (BSA ...
-
bioRxiv - Genetics 2024Quote: The resulting cDNA was amplified with primers SD6-PSPL3_RT-FW (5’-TCACCTGGACAACCTCAAAG-3’) and RTpSAD-RV (CSIC Patent P201231427) using Platinum Taq DNA polymerase (Life Technologies) and the following cycling conditions ...
-
bioRxiv - Biophysics 2024Quote: ... and 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydro (EDC, ThermoFisher). For BS3 crosslinking ...
-
bioRxiv - Genetics 2021Quote: ... The membrane was hybridized with a biotin-conjugated telomere probe (5’-biotin-CACACCCACACCCACACC-3’) and was imaged using a Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Scientific) and a Li-Cor C-DiGit Chemiluminescent Western Blot scanner.
-
bioRxiv - Neuroscience 2021Quote: ... and Standard Control (5’ CCTCTTACCTCAGTTACAATTTATA 3’) MOs (GeneTools) were diluted in distilled water and co-injected with Cascade Blue labelled dextran (Molecular Probes) into one- to two-cell wild-type (Tübingen ...
-
bioRxiv - Neuroscience 2020Quote: ... The slides were then washed in 1X PBS 3 times for 5 minutes before being incubated with Hoechst 33342 (Thermo Fisher) for 5 minutes before being washed again and coverslipped with prolong diamond (Life Technologies) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were washed 2-3 times (200 rpm, 5 min at 4°C) in eBioscience™ Permeabilization buffer (250 µl/well) (Invitrogen) and resuspended in eBioscience™ Fixation/Permeabilization solution (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... we designed more than 2 pairs of PCR primers in the 5’ and 3’ untranslated regions and inserted all resulting PCR products into pCR-Blunt-TOPO vector (Thermo Fisher). The TOPO-transcript vectors of the same gene were sequenced and compared to verify that no error was introduced to the coding sequence during reverse transcription ...
-
bioRxiv - Molecular Biology 2021Quote: ... Both halves of MF filters and entire SF filters were transferred independently to 5 mL Eppendorf tubes and 3 mL of autoclaved PBS pH 7.4 (1X) (Gibco™, Thermo Fisher) was added ...
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA oligo template (5’ TAATACGACTCACTATAGGGACACAAAACAAAAGACAAAAACACAAAACAAAAGACAAAAACA CAAAACAAAAGACAAAAAGCCTCTCCTTCTCTCTGCTTCTCTCTCGCTGTGTGCGTACAACTAGCT 3’) was PCR-amplified and then in vitro transcribed using the MEGAshortscript™ T7 Transcription kit (Invitrogen). An 11:7 ratio of the helicase RNA substrate to 5’ Alex Fluor 488 fluorescent oligo strand (Alexa Fluor 488/ AGCTAGTTGTACGCACAC ...
-
bioRxiv - Molecular Biology 2020Quote: ... We also sequentially removed the 5’ and 3’ viroid moieties from this latter plasmid via PCR with the phosphorylated primers (T4 polynucleotide kinase, Thermo Scientific) D3606 and D3285 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The MommeD43 mutation (A667E) was introduced by oligonucleotide-directed mutagenesis (5’ CTGTGCCCATTGAAAAGCTGGAT AGG; 3’ CCTATCCAGCTTTTCAATGGGCACAG) and ligated into the pFastBac Htb vector (Life Technologies). Bacmids were prepared using the Bac-to-Bac system ...
-
bioRxiv - Bioengineering 2022Quote: Primary neonatal cardiomyocytes were isolated from C57BL/6 mouse neonates on postnatal days 3-5 using the Pierce Primary Cardiomyocyte Isolation Kit (Thermo Fisher) as previously described (14) ...
-
bioRxiv - Genomics 2020Quote: ... cells were washed 3 times in 1xPBS for 5 minutes at room temperature and mounting was done in ProLong Gold with DAPI (Invitrogen, P36935). Images were collected on a LSM800 confocal microscope (Zeiss ...
-
bioRxiv - Genomics 2020Quote: ... 1,000,000 wild-type (J1) mESCs were transfected with 1µg of each 5’ and 3’ sgRNA-Cas9-mCherry plasmids using Lipofectamine 2000 (Thermo Fisher Scientific). After 24hrs of transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1.5 μg of reporter plasmid and 15 ng of Cre-plasmid was mixed with 3 μL Lipofectamine LTX reagent (Invitrogen, #15338100), 1.5 μL PLUS reagent and 100 μL Opti-MEM following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Larvae were let to recover in E3 for 3 hours and 30 minutes and then incubated for 45 minutes in 5 µM CellROX® Deep Green Reagent (Invitrogen) solution diluted in E3 without methylene blue ...
-
bioRxiv - Plant Biology 2020Quote: ... Rapid amplification of the 5’ and 3’ cDNA ends (RACE) was subsequently carried out by using the First Choice RLM-RACE kit from Ambion (USA), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... targeting the TLR3 gene (5’-CCUGAUGAUCUUCCCUCUAACAUAA-3’) and Stealth RNAi siRNA negative control med GC Duplex #2 were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: Samples were reconstituted in 3% ACN/ 5% FA prior to LC-MS/MS analysis on a Fusion Lumos or Orbitrap Exploris 480 (Thermo Scientific). A pool of two IPs was injected twice as a technical replicate ...
-
bioRxiv - Neuroscience 2021Quote: ... we added a 1 mL of the following mixture to the culture media and incubated the cells at 25°C incubator for 1—3 hours: 5 μM Fura-2 AM (F-1201, Life Technologies), 250 μM probenecid (162-26112 ...
-
bioRxiv - Microbiology 2020Quote: ... An amplicon was amplified encoding the S protein with a 19 amino acid truncation of the cytoplasmic tail using primers containing flanking 5’-KpnI and 3’-XhoI sites and cloned into pcDNA6 (Invitrogen, Inc.). To construct the ACE2 expression vector pLenti.ACE2-HA ...
-
bioRxiv - Biophysics 2021Quote: ... plus 1% penicillin/streptomycin in a humidified incubator at 37 °C and 5% CO2 and passaged every 3-4 days using 0.05% of Trypsin-EDTA (Thermo Fisher Scientific) to lift the cells from the culture dish ...
-
bioRxiv - Neuroscience 2020Quote: ... tissues were washed in PBS (3×5 min) and incubated with secondary antibodies conjugated to Alexa Fluor 488 (1:400; goat anti–rabbit; Life Technologies) or Alexa Fluor 594 (1:400 ...
-
bioRxiv - Microbiology 2021Quote: ... 3-5 µg of protein was subjected to nanoflow liquid chromatography on an EASY-nLC system (Thermo Fisher Scientific, Bremen, Germany) on-line coupled to an Q Exactive HF quadrupole orbitrap mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: ... Aliquots of the RNA preparations were subjected to RT with primer PI (5’-AGGCTTGCAAACGGAGTCTAA-3’) and RevertAid reverse transcriptase (Thermo Scientific). RT products were amplified by PCR with Thermus thermophilus DNA polymerase (Biotools ...
-
bioRxiv - Microbiology 2021Quote: ... 1.5 µl of 3 ng µl-1 cDNA was used as template in the QuantStudio 5 Real-Time PCR system (Applied Biosystems). Amplifications were performed with 5 μl of SYBR® green JumpStart Taq ReadyMix (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... the peptides were resuspended in 3% formic acid (FA)/5% acetonitrile (ACN) and loaded onto a nanoLC system (RSLCnano, Thermo Scientific). First ...
-
bioRxiv - Cell Biology 2020Quote: ... alongside Chameleon Duo Protein Ladder (3 μL/lane; LiCOR, 928-60000) or PageRuler Protein Ladder (5 μL/lane; Thermo Scientific, 26616) and run in pre-chilled 1X MOPS Buffer (Thermo ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytospins, Matrigel cultures were blocked with 3% bovine serum albumin (BSA, Fisher Bioreagents) and 5% normal goat serum (NGS, Gibco #PCN5000) in PBS for 1 hour at room temperature ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: Groups of 16 larvae at 5 dpf from all corresponding genotypes (N = 3 per genotype) were collected and stored in RNAlater (Thermo Fisher) until use ...
-
bioRxiv - Molecular Biology 2022Quote: ... lysine to arginine (residue K816), and serine to alanine (residues S820, S824, S825) within 5’ GATGGTATTTTGCCCAGGAGTCAGCATGAATCCAGT 3’ d812-827a were purchased from Thermo Scientific and ligated into the backbone ...
-
bioRxiv - Immunology 2022Quote: ... membranes were washed three times with PBS-T and then incubated with appropriate secondary antibody conjugated with alkaline phosphatase that provides a visual color change upon addition of the chromogenic substrate (mixture of BCIP (5-bromo-4chloro-3-indolyl phosphate-catalog# 34040) and NBT (nitro-blue tetrazolium chloride, catalog# 34035 from Thermo Scientific)).