Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for Benzyl 2 3 4 5 6 d5 dimethyltetradecylammonium Bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... nuclei were visualized with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 0.2 μg/ml; Life Technologies). Finally ...
-
bioRxiv - Neuroscience 2024Quote: ... The nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI: Thermo Fisher Scientific Cat D1306). The use of P2Y13 ...
-
bioRxiv - Immunology 2024Quote: ... cell viability was measured using 4′,6-diamidino-2-phenylindole (DAPI; ThermoFisher Scientific, Catalog No. 62248) where only dead cell nuclei would be labelled ...
-
bioRxiv - Cell Biology 2024Quote: ... ProLong Gold Diamond 4′,6-diamidino-2-phenylindole (DAPI) mounting media was purchased from Invitrogen (#P36962). Trpv4 antagonist GSK2193874 (GSK219 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Plant Biology 2020Quote: ... on 4-16% (Figures 4A and 7) or 3-12% (Figures 4C and 6) NativePAGE gels (Life technologies). Cathode Running buffer (Life technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... 6′-diamidino-2-phenylindole (Invitrogen). All observations were performed on a Nikon E600 epifluorescence microscope ...
-
bioRxiv - Cancer Biology 2024Quote: ... recombinant mouse Interleukin-6 (IL-6, 4 ng/mL, Thermo Fisher), recombinant human FMS like tyrosine kinase 3 ligand (FLT3-L ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
Potassium channel-driven bioelectric signaling regulates metastasis in triple-negative breast cancerbioRxiv - Cancer Biology 2021Quote: ... CDH11 #4: 5’-CCUUAUGACUCCAUUCAAA-3’ using Lipofectamine RNAiMAX transfection reagent (13778030; ThermoFisher Scientific, Waltham, MA) in serum-free DMEM ...
-
bioRxiv - Genetics 2023Quote: ... Ethidium bromide (EBr) (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 cells (Shanbhag et al., 2010) were cultured in McCoy’s 5A (Modified) Medium (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... and benzyl benzoate (BABB) (Cat. No. 105860010; Acros Organics, USA), which was replaced every 12-24 h at least 3-5 times until optimally cleared before imaging.
-
bioRxiv - Biochemistry 2021Quote: ... Succinimidyl 6-(4, 4’-azipentanamido)hexanoate (LC-SDA; Thermo Scientific) crosslinking was performed by adding the reagent to final 1mM concentration ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were electrophoresed on a 2% agarose gel made with Ethidium Bromide (Fisher Scientific) and imaged on a ChemiDoc Touch (Bio-Rad).
-
bioRxiv - Bioengineering 2024Quote: Coronal sections of healthy murine brain were prepared and stained as previously described101 either using 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng mL−1; Molecular Probes) to stain cell nuclei or primary antibodies for rabbit anti-NeuN (1:1000) ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Genetics 2024Quote: ... All cells were treated with 6 µg/mL ethidium bromide (EtBr) and 0.05 µg/mL KaryoMAX (Gibco; Cat #: 15212012) prior to harvest ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... Reverse 5′-CGA AGG TGT GAC TTC CAT G-3′) on a QuantStudio 6 Flex thermocycler (Applied Biosystems). Standard curve was established in parallel using purified SARS-CoV-2 viral RNA.
-
bioRxiv - Genetics 2020Quote: ... D5 and D10 cells using Trizol reagent (Thermo Fisher Scientific, 15596018). Reverse transcription was accomplished with Reverse Transcription Kit (Takara ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-cytokeratin 5/6 (Invitrogen, MA191106) (1:100 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Cell Biology 2020Quote: ... then stained for one minute with 30 ng/mL 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, D1306) in 1x PHEM ...
-
bioRxiv - Cell Biology 2020Quote: ... a 1:1000 dilution of DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride, Molecular Probes; D1306, Molecular Probes)/PBS solution or 5 mg/ml Hoescht (Invitrogen)/PBS solution was carried out for 15 min at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... a 1:1000 dilution of DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride, Molecular Probes; D1306, Molecular Probes)/PBS solution or 5 mg/ml Hoescht (Invitrogen)/PBS solution was carried out for 15 min at RT ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissue nuclei were visualized with nuclear stain 4′,6-diamidino-2-phenylindole (DAPI, 62247; Thermo Fisher Scientific). Coverslips were mounted using Prolong Gold (P36934 ...
-
Prom1 and Notch regulate ciliary length and dynamics in multiciliated cells of the airway epitheliumbioRxiv - Cell Biology 2022Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) was used to stain intracellular DNA (NucBlue, Thermo Fisher, Waltham, MA). Alexa Fluor 647 Phalloidin (Thermo Fisher ...
-
bioRxiv - Genomics 2020Quote: ... Sections were stained with DAPI (4′,6′-diamidino-2-phenylindole) and mounted in Prolong Gold (Life Technologies). Images were obtained by confocal microscopy (Nikon C2+ Eclipse ...
-
Therapy-induced lipid uptake and remodeling underpin ferroptosis hypersensitivity in prostate cancerbioRxiv - Cancer Biology 2020Quote: ... and Nuclear DNA was counterstained with 1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher). Alternatively ...
-
bioRxiv - Cell Biology 2021Quote: ... then stained for one minute with 30 ng/mL 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen D1306) in 1x PHEM ...
-
bioRxiv - Neuroscience 2020Quote: ... the slides were incubated in 1μg/ml of 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) at RT for 10min ...
-
bioRxiv - Cell Biology 2021Quote: ... Sections were mounted with ProLong Diamond Antifade Mountant with 4′,6-diamidino-2-phenylindole (DAPI; Life Technologies) and imaged using a Leica SP5 DMI (zebrafish sections ...
-
bioRxiv - Cell Biology 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (cat#D-1306) and TRIzolTM (cat#15596018) were purchased from ThermoFisher Scientific (Waltham ...
-
bioRxiv - Biophysics 2020Quote: ... Nuclei were detected by staining with 4’,6-diamidino-2-phenylindole (DAPI, 1:200, ThermoFisher Scientific, USA) for 10 minutes at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... The nuclei were stained with 300 nM DAPI (4’,6-diamidino-2-phenylindole; Thermo Fisher Scientific, Slovakia) for 1 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Cover glasses were mounted on slides with mountant with 4’,6-diamidino-2-phenylindole (DAPI) (Life Technologies) and imaged with a confocal microscope.
-
bioRxiv - Bioengineering 2022Quote: ... cells were stained with antibodies and 500ng/mL 4′,6-diamidine-2′-phenylindole dihydrochloride (DAPI, Invitrogen # D1306). Samples were analyzed on an LSR II flow cytometer (BD).
-
bioRxiv - Neuroscience 2020Quote: ... sections were counterstained with 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI, D3571, Molecular Probes, dilution 1:1000), re-washed ...
-
bioRxiv - Neuroscience 2022Quote: ... 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI) staining was used to visualize the nuclei (Thermo Fisher Scientific). Fluorescence was assessed using a fluorescence laser microscope (LSM780 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Alexa Fluor™ 488 (#C10337) and 4’,6-diamidino-2-phenylindole (DAPI; #62248) were purchased from Invitrogen-ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... The nucleus was stained with 50 ng/ml 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen Cat. #D1306) for 10 min at room temperature ...
-
bioRxiv - Physiology 2020Quote: ... 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI) staining was used to visualize the nuclei (Thermo Fisher Scientific). Fluorescence was assessed using a fluorescence laser microscope (LSM780 ...
-
Glycogen Synthase Kinase 3 regulates the genesis of the rare displaced ganglion cell retinal subtypebioRxiv - Neuroscience 2021Quote: ... Sections were counterstained with 1:1000 4′,6-diamidino-2-phenylindole (DAPI) (1 mg/mL, Thermo Scientific).
-
bioRxiv - Neuroscience 2022Quote: ... Sections were counterstained with 4’,6-diamino-2-phenylindole dihydrochloride (DAPI, 1:10000 in PBS, Thermo Scientific) and mounted with a cover glass using Fluoromount (Diagnostic BioSystems ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were visualized with Hoechst (4′,6-diamidino-2-phenylindole) (DAPI) (Invitrogen; 3258, ICC/IHC 1:5,000).
-
bioRxiv - Physiology 2022Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (1:2500, DAPI, ThermoFisher Scientific, Cat No. D1306). Images were taken using Zeiss 880 confocal microscopy and quantified by using Fiji/ImageJ86.
-
bioRxiv - Developmental Biology 2024Quote: ... Antibodies were used together with DAPI (4’,6-diamidino-2-phenylindole, Thermo Scientific, 62248, 1:1,000 dilution). NDE1 (Abnova ...