Labshake search
Citations for Lamda Biotech :
1 - 7 of 7 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
bioRxiv - Microbiology 2024Quote: ... PCR amplification was done using the Taq Plus 2X PCR MasterMix (Lamda Biotech) with standard cycle conditions according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... PCRs used GoGreen Taq Plus Master Mix (Lamda Biotech) with general cycling conditions of 95 C for 2 min ...
-
bioRxiv - Synthetic Biology 2020Quote: Remove unligated oligos using a PCR purification column (Lamda Biotech).
-
bioRxiv - Microbiology 2024Quote: ... All PCR reactions were purified using The Column-PureTM Clean-Up Kit (Lamda Biotech), according to the manufacturer’s instructions (Lamda Biotech).
-
bioRxiv - Developmental Biology 2020Quote: Genomic DNA was extracted from frozen tissue using Tissue Direct PCR kit (Lamda Biotech D300-100), amplified using Taq Polymerase 2X PCR premix (Intact Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA used for PCR reactions was isolated using The Column-PureTM Bacterial Genomic DNA Kit (Lamda Biotech), according to the manufacturer’s instructions ...