Labshake search
Citations for Lamda Biotech :
1 - 3 of 3 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... PCRs used GoGreen Taq Plus Master Mix (Lamda Biotech) with general cycling conditions of 95 C for 2 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
bioRxiv - Microbiology 2024Quote: ... PCR amplification was done using the Taq Plus 2X PCR MasterMix (Lamda Biotech) with standard cycle conditions according to the manufacturer’s instructions ...