Labshake search
Citations for Lamda Biotech :
1 - 2 of 2 citations for 6 Fluoro 2 3 dihydro 4H 1 benzothiopyran 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2024Quote: ... Amplified samples were run on a 2% agarose gel (Lamda Biotech, Inc., A113-3) containing 0.5μg/mL ethidium bromide (Millipore Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: ... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...