Labshake search
Citations for AUM BioTech :
1 - 2 of 2 citations for L Alanine N T Boc 2 13C 98 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... ASOs were incubated with activated CD4+ T cell in vitro for 48hrs according to manufacturer instructions (AUM BIOTECH).
-
bioRxiv - Immunology 2022Quote: ... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...