Labshake search
Citations for AUM BioTech :
1 - 2 of 2 citations for Anti Cathepsin D HC Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... GSN knockdown experiments were performed using 2’-deoxy-2’-fluoro-D-arabinonucleic acid antisense oligonucleotides (FANA Antisense Oligos; FANA ASOs) against GSN or scrambled control FANA purchased from AUM BioTech.
-
bioRxiv - Immunology 2022Quote: ... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...