Labshake search
Citations for AUM BioTech :
1 - 6 of 6 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... we purchased custom designed ASO-FANA oligos targeting the mRNA of RFNG (Aum Biotech, USA). We used either 10nM of control/scramble or RFNG FANA-ASO during the culture period.
-
bioRxiv - Systems Biology 2023Quote: The antisense oligos to target the Nfkbia gene were designed by Aum Biotech, LLC (Philadelphia ...
-
bioRxiv - Cancer Biology 2022Quote: ... GSN knockdown experiments were performed using 2’-deoxy-2’-fluoro-D-arabinonucleic acid antisense oligonucleotides (FANA Antisense Oligos; FANA ASOs) against GSN or scrambled control FANA purchased from AUM BioTech.
-
bioRxiv - Immunology 2022Quote: ... ASOs were incubated with activated CD4+ T cell in vitro for 48hrs according to manufacturer instructions (AUM BIOTECH).
-
bioRxiv - Immunology 2022Quote: ... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
bioRxiv - Cancer Biology 2020Quote: FANA antisense oligos (ASOs) were obtained from AUM Biotech. LNCaP cells were transfected with 250 nM ASO (Non-target or pool of 4 targeting TMEFF2 ...