Labshake search
Citations for Primerdesign :
1 - 3 of 3 citations for Mouse Anti MERS Coronavirus Spike S1 Antibody 3871 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... To measure SARS-CoV-2 replication in AEC cultures we used the Genesig® Coronavirus Strain 2019-nCoV Advanced PCR Kit (Primerdesign®), with duplicate assays of harvested RNA from each SARS-CoV-2-infected AEC experimental condition ...
-
bioRxiv - Biochemistry 2021Quote: ... with triplicate assays of harvested RNA from each SARS-CoV-2-infected AEC donor cell line (Genesig® Coronavirus Strain 2019-nCoV Advanced PCR Kit, Primerdesign®, Southampton, UK). The concentration of RNA harvested from AECs was used to normalize the qPCR data and was measured on a spectrophotometer (Nanodrop®).
-
bioRxiv - Neuroscience 2023Quote: ... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...