Labshake search

1 - 8 of 8 citations for Mouse Anti Human Papilloma virus types 16 18 716 D1 since 2019

• Airway epithelial interferon response to SARS-CoV-2 is inferior to rhinovirus and heterologous rhinovirus infection suppresses SARS-CoV-2 replication

  Elizabeth R. Vanderwall, et al., bioRxiv - Immunology 2021

  Quote: ... to measure HRV-16 replication in AEC cultures we used the Genesig® Human Rhinovirus Subtype 16 PCR Kit (Primerdesign®).
• Translation elongation factor 1A2 (eEF1A2) is encoded by one of four closely related eef1a genes and is dispensable for survival in zebrafish

  Nwamaka J. Idigo, et al., bioRxiv - Genetics 2019

  Quote: ... NADH and 16S (selected using the geNorm kit from PrimerDesign Ltd UK). Prevalidated primers (PrimerDesign Ltd UK ...
• An autocrine Vitamin D-driven Th1 shutdown program can be exploited for COVID-19

  Reuben McGregor, et al., bioRxiv - Immunology 2020

  Quote: ... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
• First detection of Infectious Spleen and kidney Necrosis Virus (ISKNV) associated with massive mortalities in farmed tilapia in Africa

  José Gustavo Ramírez-Paredez, et al., bioRxiv - Microbiology 2020

  Quote: Nucleic acids were used for the detection of tilapia lake virus and nodavirus by quantitative PCR using the commercial kits: Path-TiLV-EASY and Path-Betanodavirus-EASY (Primerdesign, Southampton, UK) in the platform Genesig q16® (Primerdesign ...
• Differential innate immune response of endometrial cells to porcine reproductive and respiratory syndrome virus type 1 versus type 2

  Muttarin Lothong, et al., bioRxiv - Microbiology 2022

  Quote: ... swine fever or PRRSV was assessed by a multiplex reverse transcription quantitative polymerase chain reaction (RT-qPCR) detection kit (Microplasma 16 s Ribosomal RNA Gene Genesig® Standard kit, [Primerdesign, Camberley ...
• Collagen (I) homotrimer potentiates the osteogenesis imperfecta (oim) mutant allele and reduces survival in male mice

  Katie J. Lee, et al., bioRxiv - Physiology 2021

  Quote: Detection of murine Col1a2 wild-type and mutant alleles was performed using a custom snpsig™ real-time PCR mutation detection/allelic discrimination kit (Primerdesign, Southampton, UK). 10 ng of cDNA was added to 10 μl of PrecisionPLUS mastermix (Primerdesign ...
• The molecular principles governing HCMV infection outcome

  Michal Schwartz, et al., bioRxiv - Microbiology 2022

  Quote: ... using FAM labeled HCMV primer and probe: Human CMV HHV5 kit for qPCR using a glycoprotein B target (PrimerDesign); and HEX labeled RPP30 copy number assay for ddPCR (Bio-Rad) ...
• Endogenous epitope tagging of eEF1A2 in mice reveals early embryonic expression of eEF1A2 and subcellular compartmentalisation of neuronal eEF1A1 and eEF1A2

  Faith C.J. Davies, et al., bioRxiv - Neuroscience 2023

  Quote: ... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...