Labshake search
Citations for Primerdesign :
1 - 7 of 7 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 gp41 1911 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: Nucleic acids were used for the detection of tilapia lake virus and nodavirus by quantitative PCR using the commercial kits: Path-TiLV-EASY and Path-Betanodavirus-EASY (Primerdesign, Southampton, UK) in the platform Genesig q16® (Primerdesign ...
-
bioRxiv - Microbiology 2022Quote: ... using FAM labeled HCMV primer and probe: Human CMV HHV5 kit for qPCR using a glycoprotein B target (PrimerDesign); and HEX labeled RPP30 copy number assay for ddPCR (Bio-Rad) ...
-
bioRxiv - Immunology 2021Quote: ... to measure HRV-16 replication in AEC cultures we used the Genesig® Human Rhinovirus Subtype 16 PCR Kit (Primerdesign®).
-
bioRxiv - Neuroscience 2023Quote: ... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCR reactions were performed in duplicate or triplicate in 10μl volumes using 2μl diluted cDNA (~8ng cDNA per well assuming 1:1 conversion) in a CFX384 lightcycler using PrecisionPLUS SYBR green qPCR mastermix (Primerdesign), with a melt curve included as standard (Supplementary Figure S1) ...
-
bioRxiv - Genetics 2019Quote: ... Primer sequences shown in appendix table 1 are copyrighted by PrimerDesign Ltd UK ...
-
bioRxiv - Bioengineering 2020Quote: ... RNA (1 µg) was transcribed using the Precision mqScript Reverse Transcription Kit (Primerdesign Ltd, UK) according to the manufacturer’s protocol and the cDNA was diluted 1:2 in molecular biology grade water (Sigma,UK) ...