Labshake search
Citations for Primerdesign :
1 - 2 of 2 citations for Mouse Anti Herpes Simplex Virus gD 0197 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: Nucleic acids were used for the detection of tilapia lake virus and nodavirus by quantitative PCR using the commercial kits: Path-TiLV-EASY and Path-Betanodavirus-EASY (Primerdesign, Southampton, UK) in the platform Genesig q16® (Primerdesign ...
-
bioRxiv - Neuroscience 2023Quote: ... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...