Labshake search
Citations for Primerdesign :
1 - 4 of 4 citations for IL 10 Mouse CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... 10 ng of cDNA was added to 10 μl of PrecisionPLUS mastermix (Primerdesign, Southampton, UK), 1 μl of the custom genotyping primer/probe mix and 4 μl nuclease free water per reaction ...
-
bioRxiv - Immunology 2019Quote: ... 10 ng cDNA was added to 2.5 μL 2X qPCR FAST mastermix (Primerdesign). 0.1 μL primer + Taqman probe mix (Table.M2 ...
-
bioRxiv - Neuroscience 2023Quote: ... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10 µl qRT-PCR reactions were performed using Precision PLUS qPCR Master Mix with SYBR green (PrimerDesign) in 384-well white plates on a Roche LightCycler 480 ...