Labshake search
Citations for Primerdesign :
1 - 37 of 37 citations for Biotin Z Antibody Internalization Kit rabbit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... swine fever or PRRSV was assessed by a multiplex reverse transcription quantitative polymerase chain reaction (RT-qPCR) detection kit (Microplasma 16 s Ribosomal RNA Gene Genesig® Standard kit, [Primerdesign, Camberley ...
-
bioRxiv - Microbiology 2020Quote: ... Genesig® Plasmodium species kits (Primerdesign™ Ltd, UK) according to manufacturers’ protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Genesig Easy DNA/RNA Extraction Kit (Primerdesign, Southampton, UK) and stored until further use.
-
bioRxiv - Molecular Biology 2020Quote: ... All cDNA was prepared using the RTnanoscript2 kit (Primerdesign), using 1600ng of RNA per reaction ...
-
bioRxiv - Microbiology 2021Quote: ... Genesig Easy DNA/RNA Extraction Kit (Primerdesign, Southampton, UK). PCR reactions consisted of each primer at 10 μM ...
-
bioRxiv - Cell Biology 2021Quote: ... The qPCR was performed using SYBR green based PrecisionFAST kit (Primerdesign) in Bio-Rad CFX96 Touch™ real-time PCR detection system ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... according to the instructions provided by nanoScript2 Reverse Transcription Kit (Primerdesign Ltd). cDNA was stored at -20°C until its use in qPCR [46].
-
bioRxiv - Genetics 2019Quote: ... NADH and 16S (selected using the geNorm kit from PrimerDesign Ltd UK). Prevalidated primers (PrimerDesign Ltd UK ...
-
bioRxiv - Neuroscience 2020Quote: ... and RNA was reverse transcribed by Nanoscript reverse transcription kit (Primerdesign, UK) with the final working cDNA concentration of 1ng/μL ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reverse transcription was performed using Precision NanoScript 2 Reverse-Transcription-kit (PrimerDesign) and qPCR using PrecisionPLUS 2x qPCR MasterMix with ROX and SybrGreen (PrimerDesign) ...
-
bioRxiv - Microbiology 2019Quote: ... and using DENV RT primer/probe Mix kit (Genesig, Primerdesign Ltd., UK) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... a Primer Design Real-Time PCR Internal Control Kit (PrimerDesign, Southampton, United Kingdom) was used ...
-
bioRxiv - Molecular Biology 2020Quote: ... B2M and PAK1IP1 were taken from the geNorm and geNorm PLUS kits (Primerdesign): all give efficiencies of 95-105% and produce single amplicons ...
-
bioRxiv - Molecular Biology 2020Quote: ... and reverse transcribed to cDNA using a Precision Reverse Transcription kit (PrimerDesign, Southampton, UK) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... and reverse transcribed to cDNA using a Precision Reverse Transcription kit (PrimerDesign, Southampton, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... RNA (1 µg) was transcribed using the Precision mqScript Reverse Transcription Kit (Primerdesign Ltd, UK) according to the manufacturer’s protocol and the cDNA was diluted 1:2 in molecular biology grade water (Sigma,UK) ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription primed by random nonamer primers was conducted using nanoScript 2 Reverse Transcription kit (Primerdesign). The qPCR was performed using SYBR green based PrecisionFAST kit (Primerdesign ...
-
bioRxiv - Microbiology 2020Quote: ... The extracted nucleic acids were tested using the commercial kit Path-ISKNV-EASY (Primerdesign, Southampton, UK) in the platform Genesig q16® (Primerdesign ...
-
bioRxiv - Pathology 2020Quote: ... bacterial DNA was extracted using Genesig® Easy DNA/RNA Extraction Kit (Primerdesign Ltd, Southampton UK) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... RNAemia levels were measured by a One-Step qRT-PCR detection kit (Oasig, Primerdesign Ltd., UK) and using DENV RT primer/probe Mix kit (Genesig ...
-
bioRxiv - Cell Biology 2021Quote: ... The subsequent reverse transcription was conducted using nanoScript 2 Reverse Transcription kit and random nanomer primers (Primerdesign). The real time PCR was performed on Bio-Rad CFX96 Touch using SYBR-green-based PrecisionFAST with LOW ROX qPCR kit (Primerdesign) ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA was then converted to complementary DNA (cDNA) using the Precision™ Reverse-Transcription Premix 2 kit (PrimerDesign LTD) per manufacturer’s directions ...
-
bioRxiv - Microbiology 2022Quote: ... using FAM labeled HCMV primer and probe: Human CMV HHV5 kit for qPCR using a glycoprotein B target (PrimerDesign); and HEX labeled RPP30 copy number assay for ddPCR (Bio-Rad) ...
-
bioRxiv - Cell Biology 2022Quote: ... Their genomic DNA (gDNA) residuals were removed from samples with DNase I from PrecisionDNAse kit (Primerdesign, Blirt DNA, Gdansk, Poland). Purified RNA (500 ng ...
-
bioRxiv - Bioengineering 2019Quote: ... Gene expression was measured directly from 5 ng RNA using a one-step RT PCR kit with SYBR dye (PrimerDesign). qPCR was run on the BioRad CFX96 platform ...
-
bioRxiv - Microbiology 2020Quote: ... For this the homogenised tissues were subjected to total nucleic acids extraction (~20mg of each organ) using the Genesig Easy DNA/RNA Extraction Kit (Primerdesign) as described earlier ...
-
bioRxiv - Cell Biology 2021Quote: ... The real time PCR was performed on Bio-Rad CFX96 Touch using SYBR-green-based PrecisionFAST with LOW ROX qPCR kit (Primerdesign). The reading was normalized by that of β-tubulin transcript (TUBB) ...
-
bioRxiv - Bioengineering 2019Quote: ... Relative gene expression was measured from a total of 5 ng RNA using a one-step qPCR kit with SYBR dye (PrimerDesign) and normalized to GAPDH or 18S ribosomal RNA housekeeping gene ...
-
bioRxiv - Bioengineering 2020Quote: ... SPP1 and ALPL was determined using 5 ng of total RNA and a one-step SYBR-based quantitative polymerase chain reaction kit (PrimerDesign). Gene expression assays were run on a BioRad CFX96 platform ...
-
bioRxiv - Neuroscience 2023Quote: ... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
bioRxiv - Immunology 2021Quote: ... to measure HRV-16 replication in AEC cultures we used the Genesig® Human Rhinovirus Subtype 16 PCR Kit (Primerdesign®).
-
bioRxiv - Immunology 2020Quote: ... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
bioRxiv - Microbiology 2020Quote: Nucleic acids were used for the detection of tilapia lake virus and nodavirus by quantitative PCR using the commercial kits: Path-TiLV-EASY and Path-Betanodavirus-EASY (Primerdesign, Southampton, UK) in the platform Genesig q16® (Primerdesign ...
-
bioRxiv - Immunology 2021Quote: ... To measure SARS-CoV-2 replication in AEC cultures we used the Genesig® Coronavirus Strain 2019-nCoV Advanced PCR Kit (Primerdesign®), with duplicate assays of harvested RNA from each SARS-CoV-2-infected AEC experimental condition ...
-
bioRxiv - Physiology 2021Quote: Detection of murine Col1a2 wild-type and mutant alleles was performed using a custom snpsig™ real-time PCR mutation detection/allelic discrimination kit (Primerdesign, Southampton, UK). 10 ng of cDNA was added to 10 μl of PrecisionPLUS mastermix (Primerdesign ...
-
bioRxiv - Plant Biology 2019Quote: ... and 1 µg RNA was used for cDNA synthesis with equal amounts of oligo(dT) and random nonamer primers using the nanoScript2 reverse transcription kit (Primerdesign Ltd., Southampton, UK). Transcript levels were measured by reverse transcription quantitative PCR (RT-qPCR ...
-
bioRxiv - Biochemistry 2021Quote: ... with triplicate assays of harvested RNA from each SARS-CoV-2-infected AEC donor cell line (Genesig® Coronavirus Strain 2019-nCoV Advanced PCR Kit, Primerdesign®, Southampton, UK). The concentration of RNA harvested from AECs was used to normalize the qPCR data and was measured on a spectrophotometer (Nanodrop®).