Labshake search
Citations for Primerdesign :
1 - 12 of 12 citations for 7 11 Dimethyldodeca 4 6 10 trien 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
bioRxiv - Immunology 2021Quote: ... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
bioRxiv - Microbiology 2019Quote: ... RNAemia levels were measured by a One-Step qRT-PCR detection kit (Oasig, Primerdesign Ltd., UK) and using DENV RT primer/probe Mix kit (Genesig ...
-
bioRxiv - Immunology 2021Quote: ... glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB) (Primerdesign Ltd), using the delta-CT or delta-delta Ct method[38].
-
bioRxiv - Bioengineering 2019Quote: ... Gene expression was measured directly from 5 ng RNA using a one-step RT PCR kit with SYBR dye (PrimerDesign). qPCR was run on the BioRad CFX96 platform ...
-
bioRxiv - Bioengineering 2019Quote: ... Relative gene expression was measured from a total of 5 ng RNA using a one-step qPCR kit with SYBR dye (PrimerDesign) and normalized to GAPDH or 18S ribosomal RNA housekeeping gene ...
-
bioRxiv - Bioengineering 2020Quote: ... SPP1 and ALPL was determined using 5 ng of total RNA and a one-step SYBR-based quantitative polymerase chain reaction kit (PrimerDesign). Gene expression assays were run on a BioRad CFX96 platform ...
-
bioRxiv - Physiology 2021Quote: ... 10 ng of cDNA was added to 10 μl of PrecisionPLUS mastermix (Primerdesign, Southampton, UK), 1 μl of the custom genotyping primer/probe mix and 4 μl nuclease free water per reaction ...
-
bioRxiv - Neuroscience 2023Quote: ... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
bioRxiv - Molecular Biology 2020Quote: ... Data were normalised to the geometric mean of the housekeeping genes (ubiquitin C and glyceraldehyde 3-phosphate dehydrogenase, probe-based duplex primer mix, PrimerDesign) and fold change in gene expression relative to controls was determined using the ΔΔCt method ...
-
bioRxiv - Immunology 2019Quote: ... 10 ng cDNA was added to 2.5 μL 2X qPCR FAST mastermix (Primerdesign). 0.1 μL primer + Taqman probe mix (Table.M2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10 µl qRT-PCR reactions were performed using Precision PLUS qPCR Master Mix with SYBR green (PrimerDesign) in 384-well white plates on a Roche LightCycler 480 ...