Labshake search
Citations for Primerdesign :
1 - 19 of 19 citations for 6H Indolo 2 3 b quinoxaline 6 aceticacid 9 chloro 2 1 4 methylphenyl ethylidene hydrazide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... Reverse transcription was performed using Precision NanoScript 2 Reverse-Transcription-kit (PrimerDesign) and qPCR using PrecisionPLUS 2x qPCR MasterMix with ROX and SybrGreen (PrimerDesign) ...
-
bioRxiv - Cell Biology 2019Quote: ... Assays were performed using primers (Supplementary table 2) and a SYBR green master mix (Primerdesign) on a StepOnePlus system (Applied Biosciences) ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription primed by random nonamer primers was conducted using nanoScript 2 Reverse Transcription kit (Primerdesign). The qPCR was performed using SYBR green based PrecisionFAST kit (Primerdesign ...
-
bioRxiv - Cell Biology 2021Quote: ... The subsequent reverse transcription was conducted using nanoScript 2 Reverse Transcription kit and random nanomer primers (Primerdesign). The real time PCR was performed on Bio-Rad CFX96 Touch using SYBR-green-based PrecisionFAST with LOW ROX qPCR kit (Primerdesign) ...
-
bioRxiv - Genomics 2023Quote: ... in 20 µl reactions using 2 × PrecisionPlus Mastermix with SYBR Green and low ROX (PrimerDesign, Southampton, UK), with 300 nM each of forward and reverse primers ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA was then converted to complementary DNA (cDNA) using the Precision™ Reverse-Transcription Premix 2 kit (PrimerDesign LTD) per manufacturer’s directions ...
-
bioRxiv - Immunology 2020Quote: ... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
bioRxiv - Immunology 2021Quote: ... To measure SARS-CoV-2 replication in AEC cultures we used the Genesig® Coronavirus Strain 2019-nCoV Advanced PCR Kit (Primerdesign®), with duplicate assays of harvested RNA from each SARS-CoV-2-infected AEC experimental condition ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were initially examined for SARS-CoV-2 RNA by COVID-19 Genesig® Real-Time PCR assay (Primerdesign Ltd., Chander’s Ford, UK) after RNA extraction with the Magna Pure Compact system (Roche Molecular Systems Inc. ...
-
bioRxiv - Biochemistry 2021Quote: ... with triplicate assays of harvested RNA from each SARS-CoV-2-infected AEC donor cell line (Genesig® Coronavirus Strain 2019-nCoV Advanced PCR Kit, Primerdesign®, Southampton, UK). The concentration of RNA harvested from AECs was used to normalize the qPCR data and was measured on a spectrophotometer (Nanodrop®).
-
bioRxiv - Cell Biology 2024Quote: ... Relative quantification was derived using 2-ΔCt (ΔCt calculated from the mean of two normalising genes, ATP5B and B2M (PrimerDesign Ltd, primer sequence proprietary). The following primers were used ...
-
bioRxiv - Immunology 2021Quote: ... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
bioRxiv - Microbiology 2022Quote: ... using FAM labeled HCMV primer and probe: Human CMV HHV5 kit for qPCR using a glycoprotein B target (PrimerDesign); and HEX labeled RPP30 copy number assay for ddPCR (Bio-Rad) ...
-
bioRxiv - Immunology 2021Quote: ... glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB) (Primerdesign Ltd), using the delta-CT or delta-delta Ct method[38].
-
bioRxiv - Neuroscience 2023Quote: ... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
bioRxiv - Molecular Biology 2020Quote: ... Data were normalised to the geometric mean of the housekeeping genes (ubiquitin C and glyceraldehyde 3-phosphate dehydrogenase, probe-based duplex primer mix, PrimerDesign) and fold change in gene expression relative to controls was determined using the ΔΔCt method ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCR reactions were performed in duplicate or triplicate in 10μl volumes using 2μl diluted cDNA (~8ng cDNA per well assuming 1:1 conversion) in a CFX384 lightcycler using PrecisionPLUS SYBR green qPCR mastermix (Primerdesign), with a melt curve included as standard (Supplementary Figure S1) ...
-
bioRxiv - Genetics 2019Quote: ... Primer sequences shown in appendix table 1 are copyrighted by PrimerDesign Ltd UK ...
-
bioRxiv - Bioengineering 2020Quote: ... RNA (1 µg) was transcribed using the Precision mqScript Reverse Transcription Kit (Primerdesign Ltd, UK) according to the manufacturer’s protocol and the cDNA was diluted 1:2 in molecular biology grade water (Sigma,UK) ...