Labshake search
Citations for Primerdesign :
1 - 15 of 15 citations for 6H Benzo g 1 4 diazonino 7 6 5 cd indol 6 one 10 ethenyl 1 3 4 5 7 8 10 11 12 13 decahydro 4 hydroxymethyl 8 10 13 trimethyl 7 13 bis 1 methylethyl 4S 4R* 7R* 10S* 13S* 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... 10 ng of cDNA was added to 10 μl of PrecisionPLUS mastermix (Primerdesign, Southampton, UK), 1 μl of the custom genotyping primer/probe mix and 4 μl nuclease free water per reaction ...
-
bioRxiv - Neuroscience 2023Quote: ... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
bioRxiv - Immunology 2019Quote: ... 10 ng cDNA was added to 2.5 μL 2X qPCR FAST mastermix (Primerdesign). 0.1 μL primer + Taqman probe mix (Table.M2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10 µl qRT-PCR reactions were performed using Precision PLUS qPCR Master Mix with SYBR green (PrimerDesign) in 384-well white plates on a Roche LightCycler 480 ...
-
bioRxiv - Immunology 2020Quote: ... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
bioRxiv - Bioengineering 2019Quote: ... Gene expression was measured directly from 5 ng RNA using a one-step RT PCR kit with SYBR dye (PrimerDesign). qPCR was run on the BioRad CFX96 platform ...
-
bioRxiv - Bioengineering 2019Quote: ... Relative gene expression was measured from a total of 5 ng RNA using a one-step qPCR kit with SYBR dye (PrimerDesign) and normalized to GAPDH or 18S ribosomal RNA housekeeping gene ...
-
bioRxiv - Bioengineering 2020Quote: ... SPP1 and ALPL was determined using 5 ng of total RNA and a one-step SYBR-based quantitative polymerase chain reaction kit (PrimerDesign). Gene expression assays were run on a BioRad CFX96 platform ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCR reactions were performed in duplicate or triplicate in 10μl volumes using 2μl diluted cDNA (~8ng cDNA per well assuming 1:1 conversion) in a CFX384 lightcycler using PrecisionPLUS SYBR green qPCR mastermix (Primerdesign), with a melt curve included as standard (Supplementary Figure S1) ...
-
bioRxiv - Genetics 2019Quote: ... Primer sequences shown in appendix table 1 are copyrighted by PrimerDesign Ltd UK ...
-
bioRxiv - Bioengineering 2020Quote: ... RNA (1 µg) was transcribed using the Precision mqScript Reverse Transcription Kit (Primerdesign Ltd, UK) according to the manufacturer’s protocol and the cDNA was diluted 1:2 in molecular biology grade water (Sigma,UK) ...
-
bioRxiv - Immunology 2021Quote: ... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
bioRxiv - Microbiology 2019Quote: ... RNAemia levels were measured by a One-Step qRT-PCR detection kit (Oasig, Primerdesign Ltd., UK) and using DENV RT primer/probe Mix kit (Genesig ...
-
bioRxiv - Immunology 2021Quote: ... glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB) (Primerdesign Ltd), using the delta-CT or delta-delta Ct method[38].
-
bioRxiv - Molecular Biology 2020Quote: ... Data were normalised to the geometric mean of the housekeeping genes (ubiquitin C and glyceraldehyde 3-phosphate dehydrogenase, probe-based duplex primer mix, PrimerDesign) and fold change in gene expression relative to controls was determined using the ΔΔCt method ...